Health And Family Welfare Department - Gujarat

39465913 bids are invited for microcentrifuge tubes ( q3 ) , plus charged slides ( q3 ) , autoclavable petri plates 110mm ( q3 ) , autoclavable petri plates 90mm ( q3 ) total quantity : 27900...

Health And Family Welfare Department - Gujarat

38614123 supply of laboratory items total item no 1 to 2316 (part 5: item no 1401 to 1750) corn meal agar veg,corn meal agar veg,robertsons cooked meat broth veg,robertsons cooked meat broth veg,ornithine decarboxylate broth veg,lysine decarboxylate broth veg,lysine decarboxylate broth veg,arginine dehydrolase broth veg,candida agar for differentiation of candida albicans veg,sheep blood,horse blood,aliquottes / microcentrifuge tubes,aliquottes / microcentrifuge tubes,aliquottes / microcentrifuge tubes,aliquottes / microcentrifuge tubes,alluminium rack for sv2,alluminium rack for sv2,aluminium baskets for test tubes,aluminium rack for test tubes (10 rows each of 10 holes),aluminium rack for test tubes (10 rows each of 10 holes),aluminium rack for test tubes (5 rows each of 20 holes),aluminium rack for test tubes (5 rows each of 20 holes),aluminium tray to carry slides,aluminum rack for test tubes (3 rows each of 8 holes),aluminum rack for test tubes (3 rows each of 8 holes),aluminum rack for test tubes (5 rows each of 10 holes),aluminum rack for test tubes (5 rows each of 10 holes),auto pipette – fixed volume 5 µl,auto pipette – fixed volume 20 µl,auto pipette – fixed volume 25 µl,auto pipette – fixed volume 100 µl,auto pipette – fixed volume 500 µl,auto pipette – fixed volume 5000 µl,auto pipette – variable volume 2 to 20 µl,auto pipette – variable volume 20 to 200 µl,auto pipette – variable volume 200 to 1000 µl,auto pipette – variable volume 5 to 50 µl,basket for test tubes,barrier slides,borosil glass beaker,borosil glass beaker,borosil glass beaker,borosil glass beaker,borosil glass beaker,borosil glass beaker,beaker plastic autoclavable,beaker plastic autoclavable,beaker plastic autoclavable,beaker plastic autoclavable,beaker plastic autoclavable,beaker plastic autoclavable,beaker plastic autoclavable,bottles for blood culture glass , with aluminium cap,bottles for blood culture glass , with aluminium cap,bottles for blood culture glass , with aluminium cap bakelite cap,bottles for blood culture glass , with aluminium cap bakelite cap,candle jar,candle jar,capillary tubes,conical flask glass autoclavable, without screwcap,conical flask glass autoclavable, without screwcap,conical flask glass autoclavable, without screwcap,conical flask glass autoclavable, without screwcap,conical flask glass autoclavable, without screwcap,conical flask glass autoclavable, without screwcap,conical flask glass autoclavable, without screwcap,conical flask glass autoclavable, with screwcap,conical flask glass autoclavable, with screwcap,conical flask glass autoclavable, with screwcap,conical flask glass autoclavable, with screwcap,conical flask glass autoclavable, with screwcap,conical flask glass autoclavable, with screwcap,conical flask glass autoclavable, with screwcap,coplin jars horizontal (10 grooves with lids),coplin jars vertical ( 5 grooves with lids ),coverglass 18 x 18 mm,coverglass 22 x 22 mm,coverglass 22 x 30 mm,coverglass 22 x 40 mm,coverglass 22 x 50 mm,discarding jar with lid,discarding jar with lid,discarding jar with lid,discarding jar with lid,dropping bottle,digital thermometer ( 10deg.c to 100deg. c),slide holding racks 5 1no./packet,slide staining racks 5 1no./packet,slide boxes of capacity 25/pkt,slide boxes of capacity 50/pkt,slide boxes of capacity 100/pkt,flask (flat bottom ),flask (flat bottom ),flask (flat bottom ),flask (flat bottom ),flask (flat bottom ),flask (flat bottom ),flat bottle,funnel glass,funnel glass,funnel (plastic),funnel (plastic),glass bulb for blood brown with rubber stopper,glass container with lid, round mouth,glass container with lid, round mouth,glass cuvettes (thick borosilicate glass only),hb set( sahlis acid hematin apparatus),koplin jar,measuring cylinder ,measuring cylinder ,measuring cylinder ,measuring cylinder ,measuring cylinder ,measuring cylinder,museum jars,museum jars,museum jars,museum jars,neubauer chamber improved,pasteur pipettes with latex rubber teats,pasture pipettes with rubber teats,petri dish autoclavable transparent plastic,petri dish autoclavable transparent plastic,petri dish autoclavable transparent plastic,petri dish glass,petri dish glass,petri dish gamma sterile, disposable transparent plastic,petri dish gamma sterile, disposable transparent plastic,petri dish gamma sterile, disposable transparent plastic,petri dish gamma sterile, disposable transparent plastic,petri dish gamma sterile, disposable transparent plastic,pipette 5 ml volumetric,plastic vials,plastic wash bottles with tube connected,polypropylene centrifuge tubes,polystyrene sample cups (1.5 ml),polystyrene sample cups (3 ml),pre heparinized syringe for abg analysis,pvc test tube rack (4 rows each of 12 holes),pvc test tube rack (4 rows each of 12 holes),pvc test tube rack (4 rows each of 12 holes),rack for glass pipettes,rbc pipette,refrigerator rack with cover for 0.5 ml aliquottes / microtubes,refrigerator rack with cover for 1.5 ml aliquottes / microtubes,serum storage tubes / secondary tubes with caps,slide concave,slide tray aluminium,slide tray steel 30x30 cms,slide tray steel 45x30 cms,slide trough for staining,slide plain,spirit lamp,stand for auto pipettes,storage rack for glass pipettes,test tube round bottom,test tube glass autoclavable,test tube glass autoclavable,test tube glass autoclavable,test tube glass, bakelite screw cap,test tube glass, kahn,autoclavable,test tube glass, wasserman,autoclavable,test tube round bottom,test tube round bottom,test tubes 12x100 mm (thick borosilicate glass only),test tubes 18x150 mm (thick borosilicate glass only),test tubes 12x75 mm (thick borosilicate glass only),test tubes 12x75 mm, flat bottom(thick borosilicate glass only),tubes with stopper having wings,glass tube (microcubs),urinometer,volumetric flask (500 ml),wash bottle glass or autoclavable plastic with rubber lid,wbc pipette,wintrobes tubes,wire basket for test tubes,urine collection jar,urine container,urine dipstix,westergren esr tube,esr stand,hb pippette,eye piece for microscope,hb square tube,sahlis hemoglobinometer,micro pipette 5µl,micro pipette 10µl,micro pipette 20µl,micro pipette 50 µl,micro pipette 5ml,micro pipette 10 50µl,micro pipette 20 100µl,micro pipette 50 500µl,micro pipette 100 1000µl,centrifuge tube (red cap),hand lens,widal tube ( drayer),widal tube ( conical tube),anaerobic system,petri plate carrier,test tube carrier,assorted calibrated nichrome loops,metal loop holders,microscopic slides with one end frosted (corner 90°),autoclavable, screw caped bottle with rubber diaphragm,autoclavable, screw caped bottle,wide mouthed glass jars of capacity 500gm with steel caps for viscera,glass bottle with 20cc capacity with steel screw caps for preservation of blood,wide mouthed plastic jar with plastic screw cap for viscera preservation,wide mouthed plastic jar with plastic screw cap for viscera preservation,wide mouthed plastic jar with plastic screw cap for viscera preservation,wide mouthed plastic jar with plastic screw cap for viscera preservation,wide mouthed plastic jar with plastic screw cap for viscera preservation,wide mouthed plastic jar with plastic screw cap for viscera preservation,wide mouthed plastic jar with plastic screw cap for viscera preservation,empty broad neck glass bottle with cork size: 100ml,empty broad neck glass bottle with cork size: 500ml,specimen trasport container 1 ltr.,specimen trasport container 2 ltr.,specimen trasport container 3 ltr.,specimen trasport container 5 ltr.,metal buckets for centrifuge,plastic slide box,slide box plastic,slide box plastic,slide box wooden,slide box wooden,slide dryer,adhesive stickers label 25 x 13 mm size,adhesive stickers/ labels (10mm x 22mm),labels,alluminium foil,alluminium foil,antibiotic zone scale,antibiotic zone scale,blotting paper sheet,brush for test tube washing,dimond marker pen,disposable loop (presterilized),disposable loop (presterilized),disposable loop (presterilized),disposable loop (presterilized),disposable loop (presterilized),disposable loop (presterilized),disposable microtome knife for leica microtome( 819 high profile),disposable microtome knife for leica microtome(819 low profile),filter microtips( barrier) 10 microliter,filter microtips( barrier) 20 microliter,filter microtips( barrier) 200 microliter,filter microtips( barrier) 300 microliter,filter microtips( barrier) 1000 microliter,filter microtips( barrier) 5000 microliter,filter paper whatman grade no. 1,filter paper whatman grade no. 1,filter paper whatman student grade,filter paper whatman student grade,glass marking pencil – red colour,glass marking pencil – white colour,diamond marker pen for marking on glass slide,heat, acid, alkali resistant gloves (size: 7),indicator strip for autoclave,micro tip box with transparent cover (for 10 µl tips),micro tip box with transparent cover (for 200 µl tips),micro tip box with transparent cover (for 1000 µl tips),microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,microtips,micrscope cable wires,multipurpose clinical sample collector,ohp marker pens,paper roll for thermal printer 56 mm width,permanent marker pen,strips for estimating of albumin & glucose in urine,glucostrips with glucometer (one glucometer supply free with 1000 glucostrips strips),ph indicator capsule for calibration of ph meter,ph paper (0 6),ph paper (6.5 13),ph tablets of ph 4,ph tablets of ph 7,ph tablets of ph 9,pipette stand,pipette stand,rack for vacuette , plastic,rack for vacuette , plastic,lens cleaning solution,glass beads,slide rinsing trough,tissue capsule,tourniquets for blood donation camps,wire loop nichrome, double wound,wire loop nichrome, double wound,wire loop nichrome, double wound,wire loop nichrome, double wound,wire loop with handle changeable nicrome loop embedded in ss rod with heat resistant handle double wound,asbestos gloves,specimen jars glass with accompanying lids,specimen jars glass with accompanying lids,specimen jars glass with accompanying lids,specimen jars glass with accompanying lids,anti a sera,anti b sera,anti ab sera,anti d sera,anti d sera,anti d sera,anti d sera,bovine albumin,coomb’s sera,coomb’s sera,red cell antigen panel,starter pack for preparing coomb’s control cell,red cell preserving solution for serological applications,negative control,a panel of 3% reagent red blood cells,anti – a1 sera...

Health And Family Welfare Department - Gujarat

38298277 purchase of instruments/equipments/chemicals/ glasswares /kits/models etc. for pathology department (part 1) autoclave vertical, fully automatic,autoclave vertical, fully automatic,autoclave vertical, fully automatic,autoclave double drum vertical (non microprocessor),autoclave double drum vertical (non microprocessor),autoclave double drum vertical (non microprocessor),automated nucleic acid extraction system,bact alert reflectance stanadards,binocular microscope,binocular microscope,bio safety cabinet class ii,bio safety cabinet class ii,bio safety cabinet class ii,cytospin centrifuge,gel doc,laminar air flow cabinet,micro slide cabinet,micro slide cabinet,microscope binocular,microscope monocular,microscope eyepiece lens,microscope trinocular,microscope dissecting,multipurpose refrigerated centrifuge,pharmacy refrigerator,refrigerated bench top microcentrifuge with rotors,refrigerated bench top microcentrifuge with rotors,refrigerated bench top microcentrifuge, capacity 24 32 tubes,refrigerated water bath (cryobath),semi auto analyzer,semi clinical chemistry analyzer,spectro photo meter,spectrophotometer,spectrophotometer,thermocycler,tissue floating bath,tissue homogenizer,ups line interactive,ups line interactive,ups line interactive,ups line interactive,ups line interactive,ups line interactive,ups online,ups online,water purification system for clinical laboratory,weight balance,weight balance,cryostat,flow cytometer,hplc(high performance liquid chromatography)system,hematology cell counter seven part,ihc stainer,embedding station,microtome,grossing table with digital camera & photography attachment,automatic tissue processor,automatic retrieval microwave,pressure cooker for hier,aluminum rack,aluminum rack,aluminum rack small,aluminum racks big,aluminum slide drying tray with groove,aluminum slide tray,battery for ups,battery for ups,block filing cabinet,bone marrow aspiration needle,bone marrow biopsy needle,calibration weight,1 gm,calibration weight,10 gm,centrifuge,centrifuge 16 tubes,centrifuge 8 tubes,centrifuge with brushless motor,centrifuge with brushless motor,centrifuge tubes with caps,cell counter,chiller insulated ice box,chimney,digital hemoglobinometer ( hemoglobin estimation),drum for autoclave,electric cooker for ihc,electronic timer for laboratory,electronic weighing machine,electronic weight balance,electronic weight balance , 0.1gm to 100gm,electronic weight balance , 0.1gm to 2000gm,esbach’s albuminometer,esr westergreen stand,forceps,fuch’s rosenthal chamber,gigli saw,heating elements,heating elements,heating elements,horizontal gel electrophoresis unit,horizontal gel electrophoresis unit,hot air oven,hot plate with thermostat,ihc chamber (humidity chamber),improved neubaur chambers,incubator (non microprocessor),incubator stainless steel(microprocessor and digital display),incubator stainless steel (microprocessor and digital display),induction cook top,inspissator,laboratory centrifuge,laboratory centrifuge,laboratory centrifuge,laboratory centrifuge,laboratory centrifuge,l shape mold,magnetic retreiver,magnetic stirrer / cyclomixer,manual dc blood cell counter,manual dc blood cell counter,metal loop holder,micro spin magnetic string bar,microcentrifuge,microcentrifuge,microcentrifuge,microcentrifuge,micropipette electronic,micropipette fixed volume,micropipette fixed volume,micropipette fixed volume,micropipette fixed volume,micropipette fixed volume,micropipette fixed volume,micropipette fixed volume,micropipette fixed volume,micropipette single channel, variable volume, 0.1 2.5microlitre,micropipette variable volume, multichannel,micropipette variable volume, multichannel,micropipette variable volume, multichannel 10 100 microlitre,micropipette variable volume, multichannel 20 200 microlitre,micropipette variable volume, multichannel 5 50 microlitre,micropipette variable volume, multichannel 5 50 microlitre,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,micropipette variable volume, single channel,microscope eyepiece lens,microscope objective lens,microscope objective lens,microscope objective lens,microscope objective lens,microscope objective lens,microscope objective lens,microtip holder rack,milk cooler,mini centrifuge for pcr tube strips,mini cooler minus 20 degree centigrade,mini cooler minus 20 degree centigrade,mini cooler minus 20 degree centigrade,mini cooler zero degree centigrade,mircopipette variable volume, single channel,mircopipette variable volume, single channel,motor less magnetic stirrer,photoelectric colorimeter.,pipette stand,portable ph meter – pen type,pressure cooker for i.h.c,refrigerator double door, frost free,refrigerator single door, frost free,refrigerator convertible,repeating pipette system,rotor for refrigerated centrifuge,rotor lid for refrigerated centrifuge,round magnetic string bar with pivot ring,sahli’s haemoglobinometer,sahli’s haemoglobinometer,scalpel blade,scalpel blade,scalpel blade,scalpel handle,scalpel handle,scalpel handle,scissor straight,scissor straight,scissor straight,slide rack,slide staining assembly,staining bottle rack plastic,staining bottle rack wooden,staining stand for slide staining,stainless steel tray , size 12 x 12 x 2 inches,stainless steel tray , size 18 x 12 x 2 inches,steel trolley,table top ph meter digital with combined electrode,tachometer,tachometer digital non contact type calibrated,test tube rack,test tube rack,test tube rack,test tube rack,test tube rack,test tube rack,thermo meter,thermo meter,thermo meter,thermo meter,thermo meter,thermo meter,thermo meter,thermo hygrometer,thermohygrometer calibrated,thin stainless steel probes,timer,tissue cassette round,tissue cassette square,tooth forceps,tooth forceps,transport box (capacity: 20 25 lit),transport box (capacity: 50 60 lit),transport box (capacity: 70 80 lit),transport box for blood sample test tubes,transport box/ cool box,urinometer,volume dispenser,vortex mixer,water bath,water bath,water bath,water bath,water bath,water quality testing meter,acrylic jar,acrylic jar,acrylic jar,beaker glass autoclavable,beaker glass autoclavable,beaker glass autoclavable,beaker glass autoclavable,beaker glass autoclavable,bio tips (microtips),bio tips (microtips),bio tips (microtips),bio tips (microtips),bio tips (microtips),bio tips (microtips),biotips (disposable) for micropipette,biotips (disposable) for micropipette,biotips (disposable) for micropipette,blood group tile,blotting paper sheet,brush for test tube cleaning different sizes,circled slides for cytospin centrifuge,coplin jar & lid,coverglass (microscopic ),coverglass (microscopic ),cup for acl top cts 300,cuvette for acl top cts 300,diamond pencil,disposable urine container*,dropper,eppendrof cups,eppendrof cups,esr pipette (westergren) *,esr vacuette,filter cards,filter paper,funnel plastic,glass beaker,glass beaker,glass beaker,glass beaker,glass beaker,glass capillaries,glass jar,glass rods,glass rods stand (ready to use ),glass slide (frosted),halogen lamp for microscope,hb pipette,hb square tubes,kahn tube,measuring cylinder,measuring cylinder,measuring cylinder,measuring cylinder,measuring cylinder,measuring cylinder,micro aid glass slide simple,micropipette holding stand,micropipette tips,micropipette tips,micropipette tips,micropipette tips,micropipette tips,microtome disposible blade,pasture pipettesâ with rubber tips,pep pen,ph strip,ph test strips,pipette,pipette stand,pipette stand,plastic container for specimens,plastic container for specimens,plastic container for specimens,plastic dropper bottle,plastic embedding cassattes,plastic test tube with screw cap,poly lysine coated slide,pt cuvette,rbc pipette,rubber teats(red color) for pipette,sample cup for acl top cts 300,slide rack for autostainer for histopathology,sodium heparin vacuette 2ml,sodium heparin vacuette 4ml,specimen mounted rode,spirit lamp,staining jar &lid,test tube,test tube,test tube,test tube,test tube plastic,tips holder rack,tips holder rack,tissue paper roll,tissue paper roll,tissue processing embedding cassettes,urin strip,urine strips,wasserman test tube neutral glass,wbc pipette,sticker roll,carbon paper...

Health And Family Welfare Department - Gujarat

38296543 purchase of instruments / equipments / chemicals / glasswares / kits / models etc. for mirobiology department ( part 3 ) agarose gel electrophoresis apparatus with power supply pack, air sampler system, autoclave vertical, fully automatic, autoclave vertical, fully automatic, autoclave double drum vertical ( non microprocessor ) , autoclave double drum vertical ( non microprocessor ) , autoclave double drum vertical ( non microprocessor ) , autoclave double drum vertical ( non microprocessor ) , automated nucleic acid extraction system, bact alert reflectance stanadards, battery for ups, battery for ups, bio safety cabinet class ii, bio safety cabinet class ii, bio safety cabinet class ii, biosafety cabinet class ii ( size: 2 x 2 x 2 feet inner working space. ) , biosafety cabinet class ii ( size: 4 x 2 x 2 feet inner working space. ) , bod incubator, bod incubator, bod incubator, bottle cooler 0 10o c, candle jar, candle jar, cell counter, centrifuge 08 tubes, centrifuge 16 tubes, centrifuge with brushless motor, centrifuge with brushless motor, centrifuge tubes with caps, co2 incubator, cold room with refrigeration system, colony counter digital, cytospin centrifuge, deep freeze ( 20oc ) , deep freezer ( 80oc ) , dry block heater, electric loop steriliser, electrode set, electronic needle / syringe destroyer, electronic timer for laboratory, electronic weighing machine, electronic weight balance , 0.1gm to 2000gm, electrophoresis gel casting tray, electrophoresis gel casting tray, electrophoresis power supply unit, elisa plate reader, elisa plate washer, elisa printer, filter for elisa reader, filter for elisa reader, filter for elisa reader, gel comb set, gel doc, heating block or dry bath incubator, heating block or dry bath incubator, horizontal gel electrophoresis unit, hot air oven, hot plate with thermostat, incubator stainless steel ( microprocessor and digital display ) , incubator stainless steel ( microprocessor and digital display ) , inspissator, laminar air flow cabinet, lcd projector, liquid nitrogen storage container, liquid nitrogen transport container, low voltage halogen lamp for 7300 rrt pcr machine, low voltage halogen lamp for 7500 rrt pcr machine, magnatic stand for rna extraction, magnetic retreiver, magnetic stirrer / cyclomixer, metal loop holder, microcentrifuge, microcentrifuge, microcentrifuge, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette single channel, variable volume, 0.1 2.5microlitre, micropipette variable volume, multichannel, micropipette variable volume, multichannel, micropipette variable volume, multichannel, micropipette variable volume, multichannel 10 100 microlitre, micropipette variable volume, multichannel 20 200 microlitre, micropipette variable volume, multichannel 5 50 microlitre, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, microscope binocular, microscope binocular, with dark ground attachment, microscope monocular, microscope eyepiece lens, microscope objective lens, microscope objective lens, microscope objective lens, microscope objective lens, microscope trinocular, microtip holder rack, milk cooler, mini centrifuge for pcr tube strips, mini cooler minus 20 degree centigrade, mini cooler minus 20 degree centigrade, mini cooler minus 20 degree centigrade, mini cooler minus 20 degree centigrade, mini cooler zero degree centigrade, photoelectric colorimeter., mini cooler zero degree centigrade, mini cooler zero degree centigrade, multipurpose refrigerated centrifuge, needle / syringe destroyer electronic, pcr cooler, pcr cooler zero degree centigrade, pcr tube rack, pcr tube rack with cover, pcr work station, pipette stand, plastic slide box, portable ph meter – pen type, refrigerated bench top microcentrifuge, capacity 24 32 tubes, refrigerated bench top microcentrifuge with rotors, refrigerator double door, frost free, refrigerator single door, frost free, refrigerator convertible, rotor for refrigerated centrifuge, rotor lid for refrigerated centrifuge, sharp container, spirit lamp glass, 50 ml, spirit lamp, aluminum, stabiliser, stabiliser, stabiliser, stabiliser, staining bottle rack plastic, steel trolley, table top ph meter digital with combined electrode, tachometer, tachometer digital non contact type calibrated, test tube rack, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermocycler, thermo hygrometer, thermohygrometer calibrated, transport box for blood sample test tubes, transport box / cool box, turbidometer for serological test, ultra sonic cleaner for glass or pp test tubes, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups online, ups online, ups online, ups online, ups online, ups online, ups online, ups online, vaccum cleaner, vdrl rotator ( rotary shaker ) , vdrl rotator ( rotary shaker ) , vortex mixer, water bath, water purification system for clinical laboratory, water quality testing meter, weight balance, weight balance, pcr kit real time rt pcr kit for covid 19, swab with synthetic tip, swab with synthetic tip...

Health And Family Welfare Department - Gujarat

36199889 bids are invited for molecular biology instruments minus 6 degree centigrade ultra low temperature freezer , non refrigerated microcentrifuge , multiple liquid handling manual pipette unit sets , thermal mixer , refrigerated microcentrifuge , real time pcr , thermal cycler , uv vis spectrophotometer total quantity : 8...

Department Of Pharmaceuticals - Gujarat

34006615 annual rate contract for supply of consumable items for the financial year 2022 23 1 chemicals and solvents laboratory grade chemicals, fine chemicals, bio chemicals, molecular biology grade chemicals, analytical grade chemicals, solvents, organic intermediates, reference standards and speciality fine chemicals ( ar / nmr / hplc / gc grades ) 2 bulk solvents ( 25 litre packing ) laboratory grade ( lr ) solvent commonly used in labs such as ethyl acetate, hexanes, acetone, chloroform, methanol, dichloromethane, petroleum ether 60 80, etc 3 laboratory glasswares glasswares used in chemistry, biology, and analytical laboratories 4 plastic wares general plastic wares for commonly used in chemistry, biology, and analytical laboratories, microtips, microcentrifuge tubes dnase / rnase, pyrogen free, sterile and cell culture plasticwares 5 general lab wares metalwares and rubber wares commonly used in chemistry, biology, and analytical laboratories, magnetic stirring beads, mask, gloves, biohazardbags, autoclave bags, shoe covers, pp kit, syringe filters, membrane filters, filter papers, filter paper thimbles, syringes, silicone rubber vaccum tubes, etc 6 antibodies primary, secondary antibodies for westernblot, flowcytometry, ihc, ic, 7 culture media cell culture media, reagents and growth factors, pathogen culture media, stem cell culture media 8 molecular and cellular biology items oligos, sirna, shrna, transfection / electroporation reagents, cell separation consumables, dna / protein electrophoresis / nucleic acid purificationreagents, crispr genome engineering reagents, vectors, plasmids, ips cells, inhibitors, proteins, recombinant proteins, neurotrophins, , hormones, natural proteins, viral antigens, cd antigens, chemokines, compound libraries, etc., pcr and qpcr, enzymes / restriction enzymes, diagnostic and research kits for molecular and cellular biology ( elisa, next generation sequencing library preparation kit, tapestation reagents and consumables, kinase assay etc ) flowcytometry reagents, pcr and qpcr, dna and rna oligonucleotides. 9 animal house consumables animal feed, isoflurane, animals ( rats sprague dawley, wistar, lewis ) , mice ( c57bl / 6, icr, balb / c, cd 1 nude mice, nod scid ) and animal bedding, drape 10 laboratory gases refilling of gases ( co2, o2, nitrogen ( uhp ) 99.999% gas, argon ( uhp ) 99.999% gas, zero air gas, hydrogen ( 99.999% ) gas, helium ) , liquid nitrogen gas 1 chemicals / solvents ( hplc grade, mass grade, deuterated solvents ) , chromatography columns consumables merck ( sigma aldrich, milipore ) , tci chemicals, qualigens, qiagen, qualikems, spectrochem, thermo fisher scientific, alfa aesar, fluka, across, sd fine chemicals, avra, cdh, cambridge isotope, eurisotop, himedia, jt baker, finar, srl chemicals, loba chemie, chemimpex, rankem ( avantor ) , waters, agilent, phenomenex, whatmann, kromasil, otto chemie, strem chemicals, synmr 2 glasswares borosil, corning, jsgw, riviera, duran, dwk, glassco, asgi, axiva, cole parmer, vwr, brand gmbh, sigma aldrich, tarson, thermo fisher scientific, fisherbrand, sabar scientific, rasayan 3 plastic wares and general lab wares bd falcon, bio rad, corning, thermo fisher scientific, brand gmbh, axiva, merck, polylab, tarson, eppendorf, abdos, borosil, cole parmer, vwr, polylab, whatman, genetix, genaxy, riviera, glassco, duran, asgi, borosil, sabar scientific, rasayan 4 molecular and cellular biologyenzymes, reagents and kits / biochemical / immuno chemicals abcam, ambion, amresco, axygen, bd biosciences, biorad, genaxy, corning, eppendorf, genscript, imgenex, thermo fischer scientific, invitrogen, fermentas, novagen, perkin elmer, merck life science, qiagen, lonza, takara, qualigens, sigma, promega, new england biolabs, promocell, srl, hi media, synbio, santa cruz, cytiva, trivector biomed, integrated dna technologies, agilent, cell signalling technology, novus biologics, r and d signalling, sigma aldrich, alomone lab, vector lab, anaspec, wako, atlas, genetex, symport, cayman, diagenode...

Gujarat Cancer And Research Institute - Gujarat

33716833 re tender for rate contract for laboratory glassware plasticware goods part 1 for the year 2022 2023 and 2023 24 20°c pcr mini cooler, 20°c pcr mini cooler with gel filled cover, 3 way rack, 4 way flipper rack, 4 way microtube rack, alluminium container, aspirator bottle, aspirator bottle, auto pipettes ( bluedispensing bottom ) , auto pipettes ( grey dispensing bottom ) , auto pipettes ( yellow dispensing bottom ) , auto pipettes ( yellow dispensing bottom ) , beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker plastic, beaker plastic, beaker plastic, beaker plastic, beaker plastic, beaker plastic, carboy, carboy with stopcock, centrifuge tube, centrifuge tube, centrifuge tube box, couplin jar glass, cryovial with cryo coders ( different colors ) , cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylindre plastic, cyro gloves, disposable tips, dropper rubber, fine filter tips 1250ul, fine filter tips 1250ul, flask conical glass, flask conical glass, flask conical glass, flask conical glass, flask conical glass, flask conical glass, float rack, float rack, freezing vial container with cover, funnel, funnel, funnel glass, funnel glass, funnel glass, gel comb, gel loading tips, glass marking pencil, glass rod, immersion oil dispensing bottle, long neck, lab absorbent paper roll roll, magnetic retriever, magnetic stirrer, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, micro centrifuge container, micro centrifuge tube, micro pipette tips, micro tubes work station rack, microtube pestle with motor, mini centrifuge, mini cooler with gel filled cover, mini cooler with gel filled cover, optical plates 96 well skirted 28440, optical sealing films for the 96 well optical plates cat.36590, pcr mini cooler, pcr tube, pcr tube, pipette tips, plastic brushes for laboratory good cleaning, plastic wash bottle, plastic wash bottle, plastic wash bottle, platform rocker for gels, platic forceps, rack for microtube, rack for microtube, rack for microtube, rack for pcr tube, rack for revasible rack, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reversible pcr rack, rocker, spilfyter lab sockers, super deluxe, test tube glass, test tube rack, test tube rack, test tube rack, test tube stand, thermometer glass, tips for micropipettes, tissue culture flask, tissue culture flask, tissue culture flask, tissue culture petri dish plastic, tissue culture plate 12 well, tissue culture plate 24 well, tissue culture plate 4 well, tissue culture plate 6 well, tissue culture plate 96 well, sterile connecting device, universal tips, , vortex mixer, zippette bottle top dispenser, digital thermometer & hygrometer with prob, finntip 5ml, gel casting tray for 130x 130mm, gel casting tray for 250 mm x 130 mm, low attachment 6 well plates, tissue culture, plus charged slides, stem cell cassettes ( stainless steel ) , sterile cell strainer ( por size: 70 um ) , glass petri plates 150 mm x25 mm, glass petri plates 100 mm x15 mm, pcr tubes 0.5 ml ( autoclavable , conical bottom , with graduation polypropylene ) , gel comb, biobanking and cell culture cryogenic tubes, neubar’s chamber, microcentrifuge tube, 75cm² flask, 25cm² flask, cell counting slides, qubit assay tubes, pipette with microtube opener adapter, sterile dispoasble tissue culture pipettes ( serological pipette ) , cell culture chamber with cover slide ( 8 well ) , rubber pipette bulb, rubber pipette bulb, rubber pipette bulb, test tube cleaning brushes with white nylon rounded tuft bristles, test tube cleaning brushes with white nylon rounded tuft bristles, test tube cleaning brushes with white nylon rounded tuft bristles, test tube holding forceps, glass jar, glass jar, glass jar, dropping bottle, dropping bottle, ice tray, lts tips for 10 µl volume, lts tips for 250 µl volume, micro pestle, pap pen for ihc, pcr work station rack, 0.1 ml 4 tube & 4 cap strips, halogen bulb 24 x 150, sharp container 5 ltr, needle cum hub cutter, sample container urine, sample container stool with spoon...

Civil Hospital - Gujarat

33051346 supply of laboratory equipments pathology ( consumables items, disposable items, major equipments and minor equipments ) ( part 2 ) aluminum rack, aluminum rack, aluminum rack small, aluminum racks big, aluminum slide drying tray with groove, aluminum slide tray, battery for ups, battery for ups, block filing cabinet, bone marrow aspiration needle, bone marrow biopsy needle, calibration weight, 1 gm, calibration weight, 10 gm, centrifuge, centrifuge 16 tubes, centrifuge 8 tubes, centrifuge with brushless motor, centrifuge with brushless motor, centrifuge tubes with caps, cell counter, chiller insulated ice box, chimney, digital hemoglobinometer ( hemoglobin estimation ) , drum for autoclave, electric cooker for ihc, electronic timer for laboratory, electronic weighing machine, electronic weight balance, electronic weight balance , 0.1gm to 100gm, electronic weight balance , 0.1gm to 2000gm, esbach’s albuminometer, esr westergreen stand, forceps, fuch’s rosenthal chamber, gigli saw, heating elements, heating elements, heating elements, horizontal gel electrophoresis unit, horizontal gel electrophoresis unit, hot air oven, hot plate with thermostat, ihc chamber ( humidity chamber ) , improved neubaur chambers, incubator ( non microprocessor ) , incubator stainless steel ( microprocessor and digital display ) , incubator stainless steel ( microprocessor and digital display ) , induction cook top, inspissator, laboratory centrifuge, laboratory centrifuge, laboratory centrifuge, laboratory centrifuge, laboratory centrifuge, l shape mold, magnetic retreiver, magnetic stirrer / cyclomixer, manual dc blood cell counter, manual dc blood cell counter, metal loop holder, micro spin magnetic string bar, microcentrifuge, microcentrifuge, microcentrifuge, microcentrifuge, micropipette electronic, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette fixed volume, micropipette single channel, variable volume, 0.1 2.5microlitre, micropipette variable volume, multichannel, micropipette variable volume, multichannel, micropipette variable volume, multichannel 10 100 microlitre, micropipette variable volume, multichannel 20 200 microlitre, micropipette variable volume, multichannel 5 50 microlitre, micropipette variable volume, multichannel 5 50 microlitre, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, micropipette variable volume, single channel, microscope eyepiece lens, microscope objective lens, microscope objective lens, microscope objective lens, microscope objective lens, microscope objective lens, microscope objective lens, microtip holder rack, milk cooler, mini centrifuge for pcr tube strips, mini cooler minus 20 degree centigrade, mini cooler minus 20 degree centigrade, mini cooler minus 20 degree centigrade, mini cooler zero degree centigrade, mircopipette variable volume, single channel, mircopipette variable volume, single channel, motor less magnetic stirrer, photoelectric colorimeter., pipette stand, portable ph meter – pen type, pressure cooker for i.h.c, refrigerator double door, frost free, refrigerator single door, frost free, refrigerator convertible, repeating pipette system, rotor for refrigerated centrifuge, rotor lid for refrigerated centrifuge, round magnetic string bar with pivot ring, sahli’s haemoglobinometer, sahli’s haemoglobinometer, scalpel blade, scalpel blade, scalpel blade, scalpel handle, scalpel handle, scalpel handle, scissor straight, scissor straight, scissor straight, slide rack, slide staining assembly, staining bottle rack plastic, staining bottle rack wooden, staining stand for slide staining, stainless steel tray , size 12 x 12 x 2 inches, stainless steel tray , size 18 x 12 x 2 inches, steel trolley, table top ph meter digital with combined electrode, tachometer, tachometer digital non contact type calibrated, test tube rack, test tube rack, test tube rack, test tube rack, test tube rack, test tube rack, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo meter, thermo hygrometer, thermohygrometer calibrated, thin stainless steel probes, timer, tissue cassette round, tissue cassette square, tooth forceps, tooth forceps, transport box ( capacity: 20 25 lit ) , transport box ( capacity: 50 60 lit ) , transport box ( capacity: 70 80 lit ) , transport box for blood sample test tubes, transport box / cool box, urinometer, volume dispenser, vortex mixer, water bath, water bath, water bath, water bath, water bath, water quality testing meter, autoclave vertical, fully automatic, autoclave vertical, fully automatic, autoclave vertical, fully automatic, autoclave double drum vertical ( non microprocessor ) , autoclave double drum vertical ( non microprocessor ) , autoclave double drum vertical ( non microprocessor ) , automated nucleic acid extraction system, bact alert reflectance stanadards, binocular microscope, binocular microscope, bio safety cabinet class ii, bio safety cabinet class ii, bio safety cabinet class ii, cytospin centrifuge, gel doc, laminar air flow cabinet, micro slide cabinet, micro slide cabinet, microscope binocular, microscope monocular, microscope eyepiece lens, microscope trinocular, microscope dissecting, multipurpose refrigerated centrifuge, pharmacy refrigerator, refrigerated bench top microcentrifuge with rotors, refrigerated bench top microcentrifuge with rotors, refrigerated bench top microcentrifuge, capacity 24 32 tubes, refrigerated water bath ( cryobath ) , semi auto analyzer, semi clinical chemistry analyzer, spectro photo meter, spectrophotometer, spectrophotometer, thermocycler, tissue floating bath, tissue homogenizer, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups line interactive, ups online, ups online, water purification system for clinical laboratory, weight balance, weight balance, cryostat, flow cytometer, hplc ( high performance liquid chromatography ) system, hematology cell counter seven part, ihc stainer, embedding station, microtome, grossing table with digital camera & photography attachment, automatic tissue processor, automatic retrieval microwave, pressure cooker for hier, pasture pipettesâ with rubber tips, pep pen, ph strip, ph test strips, pipette, pipette stand, pipette stand, plastic container for specimens, plastic container for specimens, plastic container for specimens, plastic dropper bottle, plastic embedding cassattes, plastic test tube with screw cap, poly lysine coated slide, sodium heparin vacuette 2ml, sodium heparin vacuette 4ml, specimen mounted rode, spirit lamp, staining jar &lid, test tube, test tube, test tube, test tube, test tube plastic, tips holder rack, tips holder rack, tissue paper roll, tissue paper roll, tissue processing embedding cassettes, urin strip, urine strips, wasserman test tube neutral glass, wbc pipette, toludine blue dye ( c.i 52040 ) , total protein estimation kit, tris edta buffer ph 9, tris powder, ttf1, tween 20, urine control, van geisons stain ( ready to use ) , vimentin, von kossa stain kit ( ready to use ) , wbc diluting fluid, whitediff h550, wright stain, wt 1, xylene, ziehl neelson ( ready to use ) , ß catenin, measuring cylinder, measuring cylinder, measuring cylinder, measuring cylinder, measuring cylinder, measuring cylinder, micro aid glass slide simple, micropipette holding stand, micropipette tips, micropipette tips, micropipette tips, micropipette tips, micropipette tips, microtome disposible blade, pt cuvette, rbc pipette, rubber teats ( red color ) for pipette, sample cup for acl top cts 300, slide rack for autostainer for histopathology...

U N Mehta Institute Of Cardiology & Research Center - Gujarat

32162933 e tender for rate contract for supply of quality controls ( internal & external ) , chemicals and consumables for laboratory services for u n mehta institute of cardiology and research centre ( affiliated to b. j. medical college & nabh accredited ) ahmedabad, gujarat, india. albumin, alkaline phos, sgpt, amylase, sgot, bili total, bili direct, calcium, chloride, cholesterol, ck total, creatinine, glucose, iron, ldh, lipase, magnesium, phosphorus, potassium, sodium, total protein, triglyceride, uibc, hdl, urea, uric acid, lipoprotein a, digoxin, apo a1, apo b, cpk mb, hscrp, bnp, homocysteine, high sensitive troponin i, urine r / m, d dimer, pt, aptt, hba1c, cbc, free psa, total psa, ferritin, free t3, free t4, t3, t4, tsh, vitamin b12, 25 ( oh ) vitamin d, procalcitonin, hbsag, hiv, crp quantitation, ammonia, direct ldl, myoglobin, cystatine c, fructosamine, ggt, lactic acid, csf protein, urine protein, alfa antitrypsin, alpha 1 glycoprotein, aso, b2 microglobulin, ceruloplasmin, c3, c4, heptoglobin, iga, igg, igm, ige, kappa light chain, lamda light chain, microalbumin, pre albumin, rhematoid factor, transferrin, amikacin, carbamazepine, digitoxin, gentamycin, lithium, phenobarbital, phenytoin, theophylline, tobramycin, vancomycin, valproic acid, alfa feto protein, ca 125, ca 15.3, ca 19.9, ca 72.4, cea, cyfra 21.1, he4, nse, pvka ii, progrp, roma, scc, gelectin 3, nt probnp, beta hcg, dhea s, estradiol, fsh, lh, progesterone, prolactin, shbg, testosterone, cmvigg, cmv igm, rubella igg, rubella igm, toxo igg, toxo igm, anti hbc igm, anti hbe, anti hcv, anti hbs, hav ab igg, hav ab igm, hbeag, hcv ag, r htlv i / ii, anti ccp, c peptide, cortisol, insulin, folate, folate rbc, pth, pepsinogen i, pepsinogen ii, chagas, ebv ebna i igg, ebv vca igg, ebv vca igm, sars cov igg against spike protein, sars cov igm against spike protein, syphilis, urine ngal, methotrexate, anti tg, anti tpo, thyroglobulin, trab, t uptake, cyclosporin, sirolimus, tacrolimus, benzo diazepine, acetaaminophen, tricyclic antidepressant, barbiturates, cannabinoids, coccaine, ecstasy, ethanol, methadone, opiates, phenacyclidine, propoxyphene, salicylate, inhibin b, h.pylori, il 6, angiotensin converting enzyme, growth hormone, herpes igg, herpes igm, sars cov 2 total antibody, acth, amh, ada, copper, zinc, g 6 pd enzyme, cholineesterase, erythropoetin, intrinsic factor antibody, high sensitive troponin t, sars cov 2 antibody against nucleocapsd, cardiac external quality control program, routine biochemestry external quality control program, immuno assay external quality control program, serum proteins external quality control program, urine analysis external quality control program, coagulation external quality control program, hematology external quality control program, therapeutic drug monitoring external quality control program, hiv hepatitis external quality control program, hba1c / haemoglobin external quality control program:, lugols iodine, 30% sulphosalicylic solution analytical grade, c.s.f.diluting fluid, tuberculin p.p.d., leishman stain solu ( cytochromic ) ready to use, wbc diluting fluid, fouchests reagent, benedicts qualitative solution, aec diluting fluids, 3.8% sodium citrate solution, d.p.x.mount ( cleanar ) , ethanol absolute, indian ink, methylene blue powder, methanol, acetic acid ( glacial ) , tuberculin p.p.d., tuberculin p.p.d., sodium hypochlorite lr, barium chloride powder lr, barium chloride solution, isopropanol "sq", ammonium sulphate analytical grade, hydrogen peroxide 30% w / v lr, new methylene blue, multistix, ketodiastix strip for detect of sugar, acetone in urine, haem test, uristix strips, reticulocyte counting fluid, hcv rapid kit strip test ( ic ) , vdrl rpr card test with controls ( charcoal antigen & accs ) , syphilis ab rapid test kit ( dip strip ) , rapid malaria kit, leptospira rapid kit ( for igm detection ) , urine pregnancy test kit ( strip ) , a.s.o.test kit, r.a. test kit, c.r.p. test kit, hiv rapid test ( without eliza reader ) , widal antigen sets ( slide agglutination antigen test ) , hbsag rapid kit, widal tube test for s.typhi o, h & paratyphi ah, bh ( pack size 4x50ml ) , widal tube test for s. typhi o, h ( pack size: 2+2x50ml ) , hbsag rapid test kit, dengue rapid kit ( to detect ns1 antigen, igm, igg antibodies, cryptococcal antigent detection test latex, tpha kit for tp antibody detection, based on ha, sickling test ( ready to use based on qualitative solubility test ) , hiv rapid ( 1 step ) , strip for detection of ketone bodies in serum, rapid hiv ag+ab detection kit ( 4th generation ) , formalin 37 41% 500 ml, hev rapid card, chikenguniya igm card test, immersion oil for routine microscopy, anti a, anti b, anti ab, anti d, anti d, anti d, anti a 1, anti h, anti human globulin, anti human globulin, anti human globulin, 22% bovine albumin, anti c antisera, anti c antisera, anti e antisera, anti e antisera, anti fya antisera, anti fyb antisera, anti lea antisera, anti leb antisera, anti lua antisera, anti lub antisera, anti p antisera, anti k, antisera, anti k antisera, antikpa antisera, antikpb antisera, anti s antisera, anti s antisera, anti m antisera, anti n antisera, anti jsa antisera, anti jsb antisera, anti jka antisera, anti jkb antisera, coombs control cells, acid elution kit, edta glycine elution kit, copper sulphate powder ( cuso4, 5 h2o ) , field stain a, field stain b, cryovial, antiseptic solution for phlebotomy, platelet additive solution 250ml, gram stains kit, alberts metachromatic stains kit, zn acid fast stains, lactophenol cotton blue, kovacs indole reagent, mcfarland standard set, giemsas stain, nigrosin stain, oxidase discs, hydrogen peroxide, immersion oil, , pottasium hydroxide flakes, brain heart infusion broth, macconkey w / o cv and nacl, w / 0.004% nr and 2.0 % agar, , mueller hinton agar, macconkey broth ( double strength ) , mannitol salt agar base, , peptone water, sabouraud dextrose agar, , tryptone soya broth, chrome candida differential, agar powder, extra purebiological grade, dextrose, anhydrous, sheep blood agar plate, xylose lysine deoxycholate agar plate, ph paper, ph tablets, ph tablets, ph tablets, ordinary filter paper sheet, fixative spray for cytology, test tube rack alluminium, test tube rack alluminium, test tube stand for test tube, disposable micro tips for auto pipetes, wooden stick, amber coloured glass dropping bottle, glass marking pencil, microscopic cover glass / cover slip, measuring cylinder 500 ml plastic autoclavable, measuring cylinder 1000 ml plastic autoclavable, improved neubers chamber, spreader slides, cover glasses 18mm square ( thin no.1 ) , urine collection jar conical, volumetric flask, volumetric flask, microscope helogen bulb, pipette 10ml graduated borosilicate glass, dropper borosilicate, thumb press dispensing dropper / / pateur pippettes, sterile disposable petri dish, funnel, aluminium horizontal tray, filter cards thick white ) with 01 hole ( for cytospin 4 ) , eppendroff tube ( alliquote ) , eppendorf tube 1.5ml non binding polypropelene tube, molecular grade, microcentrifuge tube rack, benchtop for efficient processing, empty tip box, empty tip box, centrifuge tube, centrufge tube, disposable micro tip, disposable micro tip, disposable micro tip, tips 2 200ul, tips 100 1000 ul, disposable tips small, lancets, sterile pure viscos swab, sterile container with spatula, sterile cotton swab for surveillance, mucus extractor, sterile urine collection container, leak proof, wide mouth and screw capped, plastic container for urine & stool routin micro wide mouth cap., sterilized screw capped universal plastic container cap, coplin jar ( plas.tic ) with cover stain purpose, couplin jar, band aid spot, disposable tips large, slide box plastic, tissue cutting knives, tissue cassets, conical flasks, reagent bottles, test tube holder, litmus paper, measuring cylinder, measuring cylinder, measuring cylinder, widal test tube rack, micropipette, micropipette, micropipette, test tube glass, disposable plastic test tubes, diamond marker, micropipettes . ( with stand table top & calibration certificate ) , micropipettes . ( with stand table top & calibration certificate ) , micropipettes . ( with stand table top & calibration certificate ) , micropipettes, micropipette fixed volume with calibration certificate, micropipette fixed volume with calibration certificate, micropipette fixed volume with calibration certificate, micropipette fixed volume with calibration certificate, micropipette fixed volume with calibration certificate, micropipette variale volume with calibration certificate, micropipette variale volume with calibration certificate, micropipette variale volume with calibration certificate, micropipette variale volume with calibration certificate, micropipette variale volume with calibration certificate, plastic dropping bottle, slide stand for drying ( aluminium ) , test tube brush, test tube brush, test tube brush, slide staining rack aluminium, double pointed needle for vacutainer, filter paper, retractile, single use safety lancet for capillary blood collection, edta tubes ( 2 ml ) vaccume tube, edta tubes ( 3 / 4 ml ) vaccume tube, plain gel tubes vaccume tube, sodium citrate 2.7 ml vaccum tube, disposable esr tube / pipettes, needle with safety lock or holders for vaccutainer, flash back collection needles, edta tube for peadiatric collection non vaccume tube, plain tube for peadiatric collection, sodium citrate tube for peadiatric collection non vaccume tube, plain clot activator tubes vaccume tube, sodium fluoride tubes vaccume tube, sodium heparin tubes ( 3.5 / 4 ml ) vaccume tube, sodium heparin tubes ( 5 / 6 ml ) vaccume tube, edta 2 ml non vacuum tube, edta 3 ml / 4ml non vacuum tube, plain clot activator tube non vacuum tube, plain gel tubes non vaccume tube, sodium citrate ( 2.7 ml ) non vacuum tube, sodium fluoride non vacuum tube, sodium heparin ( 3.5 / 4 ml ) non vacuum tube, sodium heparin ( 5 / 6 ml ) non vacuum tube, sterile container with spatula, flexilble inoculating loop, stabflexiloop plus, metaloop stainless steel, nichrome loop, borosilicated screw capped wide mouth jar for media preparation, mccartney bottle w / aluminium cap neutral glass, microscope glass slide, ground edges, frosted one end, glass slide, concavity slide, two cavity, borosilicated glass rimless, borosilicated glass rimless, durhams tube, ink pen for temperature recording chart, double distilled water, adsorption kit for warm autoantibody, adsorption kit for cold autoagglutinins, rapid malaria antigen detection, tpha rapid kits for syphilis detection, single blood bag ( 350 ml ) , triple blood bag ( 350 ml ) with sample pouch, triple blood bag ( 450 ml ) with sample pouch, quadruple blood bag ( 350 ml ) top and top with sample pouch, quadruple blood bag ( 450 ml ) top and top with sample pouch, quadruple blood bag ( 450 ml ) top and bottom with sample pouch, penta blood bag ( 450 ml ) with sample pouch with in line leukocyte reduction filter, transfer bags ( 300 ml ) capacity, transfer bags ( 600 ml ) capacity, quintuple in line filter bags, buffy coat pooling set, red cell leukodepletion filters lab side with transfer bag, platelet leukodepletion filters lab side, standard blood transfusion set, temperature recording chart for platelet incubator agitator remi, temperature recording chart for 400 c plasma freezer remi, temperature recording chart for 800 c plasma freezer remi, amikacin, gentamicin, netilmicin, tobramycin, doripenem, ertapenem, imipenem, meropenem, cefixime, cefoperazone, cefope.+sulbactam, cefotaxime, cefpirome, ceftazidime, ceftriaxone, cefuroxime, cephalothin, cefepime, cefepime+tazobactam, cefoxatin, ciprofloxacin, levofloxacin, moxifloxacin, nalidixic acid, norfloxacin, ofloxacin, sparfloxacin, teicoplanin, vancomycin, clindamycin / lincomycin, azithromycin, clarithromycin, erythromycin, aztreonam, linezolid, ampicillin, amox.+clav.acid, ampicillin+sulbactam, oxacillin, penicillin g, ticarcillin, ticarcillin+clav.acid, piperacillin, piperacillin +tazobactam, co trimoxazole, tetracycline, tigecycline, minocycline, chloremphenicol, nitrofurantoin, furazolidone, fosfomycin...

Surat Municipal Corporation - Gujarat

31673357 tender for procurement of laboratory chemicals, reagents, glasswares, plastics, etc., items 1 23 / 001 / 0001 / 00 / 0 / 0 / 0 alberts stain a solution ( metachrometic ) 125ml 2 23 / 001 / 0002 / 00 / 0 / 0 / 0 alberts stain b solution ( metachrometic ) 125 ml 3 23 / 001 / 0003 / 00 / 0 / 0 / 0 eosin 2% liquid ( ready to use & bsc certified ar ) 100ml 4 23 / 001 / 0004 / 00 / 0 / 0 / 0 gention violet solution 100ml 5 23 / 001 / 0005 / 00 / 0 / 0 / 0 gms iodine solution 100 ml 6 23 / 001 / 0006 / 00 / 0 / 0 / 0 carbol fuchsine for afb stain strong 500ml 7 23 / 001 / 0007 / 00 / 0 / 0 / 0 hematoxylene ( harris ) liquid ( ready to use & bsc certi. ar 100ml 8 23 / 001 / 0008 / 00 / 0 / 0 / 0 leofler methylene blue solution 500 ml 9 23 / 001 / 0009 / 00 / 0 / 0 / 0 giemsa stain solution ( ready to use prefer with buffer&bsc cert 100ml 10 23 / 001 / 0010 / 00 / 0 / 0 / 0 lugols iodine 100ml 11 23 / 001 / 0014 / 00 / 0 / 0 / 0 safranine solution 100 ml 12 23 / 001 / 0015 / 00 / 0 / 0 / 0 silver nitrate solution 10% 500ml 13 23 / 001 / 0016 / 00 / 0 / 0 / 0 30% sulphosalicylic solution analytical grade 500ml 14 23 / 001 / 0017 / 00 / 0 / 0 / 0 c.s.f.diluting fluid 100ml 15 23 / 001 / 0019 / 00 / 0 / 0 / 0 tuberculin p.p.d. ( 10tu / 0.1ml ) 5ml vial 16 23 / 001 / 0025 / 00 / 0 / 0 / 0 liquid detergent for lab purpose ( labolene ) 5 liter jar 17 23 / 001 / 0026 / 00 / 0 / 0 / 0 leishman stain solu ( cytochromic ) ready to use with bufer bsc cert 500ml 18 23 / 001 / 0027 / 00 / 0 / 0 / 0 n / 10 hydrochloric acid for hb estimation 500ml 19 23 / 001 / 0028 / 00 / 0 / 0 / 0 wbc diluting fluid 500ml 20 23 / 001 / 0033 / 00 / 0 / 0 / 0 fouchests reagent 500ml 21 23 / 001 / 0034 / 00 / 0 / 0 / 0 r.b.c. diluting fluid 500ml 22 23 / 001 / 0035 / 00 / 0 / 0 / 0 benedicts qualitative solution 1000ml 23 23 / 001 / 0037 / 00 / 0 / 0 / 0 pow.glucose analytical grade 500gm 24 23 / 001 / 0039 / 00 / 0 / 0 / 0 semen diluting fluid 100ml 25 23 / 001 / 0041 / 00 / 0 / 0 / 0 nutrient agar ( bacteriologial media ) 500gm 26 23 / 001 / 0042 / 00 / 0 / 0 / 0 macconkeys agar ( bacteriologial media ) 500gm 27 23 / 001 / 0049 / 00 / 0 / 0 / 0 eharlichs aldehyde reagent 100 ml 28 23 / 001 / 0050 / 00 / 0 / 0 / 0 ph paper 2 to 10.5 100 nos. 29 23 / 001 / 0051 / 00 / 0 / 0 / 0 tissue paper roll ( 48x2ply. 10cmx96mtr. ) 30 23 / 001 / 0055 / 00 / 0 / 0 / 0 acid alcohol for afb stain 100 ml 31 23 / 001 / 0057 / 00 / 0 / 0 / 0 brillient crysyl blue dye powder dch.stain 25 gm 32 23 / 001 / 0058 / 00 / 0 / 0 / 0 cyanmeth heaemoglobin standered 10ml 33 23 / 001 / 0059 / 00 / 0 / 0 / 0 aec diluting fluids 100ml 34 23 / 001 / 0060 / 00 / 0 / 0 / 0 ordinary filter paper sheet ( standard size ) 35 23 / 001 / 0062 / 00 / 0 / 0 / 0 fixative spray for cytology 50ml 36 23 / 001 / 0072 / 00 / 0 / 0 / 0 calibrater for biochem ( human sera based for chemistry, hormons, tumor 37 23 / 001 / 0073 / 00 / 0 / 0 / 0 control for biochem ( human sera base for chemistry, hormone, tumor levl1 38 23 / 001 / 0074 / 00 / 0 / 0 / 0 control for biochem ( human sera base for chemistry, hormone, tumor levl2 39 23 / 001 / 0085 / 00 / 0 / 0 / 0 3.8% sodium citrate solution 500ml 40 23 / 001 / 0086 / 00 / 0 / 0 / 0 seliwanott fructose reagent 100ml 41 23 / 001 / 0088 / 00 / 0 / 0 / 0 control for biochem ( human sera base for chemistry, hormone, tumor levl3 42 23 / 001 / 0089 / 00 / 0 / 0 / 0 bovine albumin flakes 5 gm 43 23 / 001 / 0092 / 00 / 0 / 0 / 0 anaerobic gas pack sachet box of 5 packets 44 23 / 001 / 0093 / 00 / 0 / 0 / 0 iron alum 100 gm 45 23 / 001 / 0095 / 00 / 0 / 0 / 0 activated charcoal 500 gm 46 23 / 001 / 0098 / 00 / 0 / 0 / 0 d.p.x.mount ( cleanar ) 250ml 47 23 / 001 / 0101 / 00 / 0 / 0 / 0 ethanol absolute 500ml48 23 / 001 / 0102 / 00 / 0 / 0 / 0 calibrator for ck mb human sera based 5ml 49 23 / 001 / 0103 / 00 / 0 / 0 / 0 o cell ( o cell prepared in liss solution ) 10 ml 50 23 / 001 / 0104 / 00 / 0 / 0 / 0 indian ink 100 ml 51 23 / 001 / 0107 / 00 / 0 / 0 / 0 methylene blue powder 25gm 52 23 / 001 / 0108 / 00 / 0 / 0 / 0 deoxycholate citrate agar 100 gms 53 23 / 001 / 0109 / 00 / 0 / 0 / 0 lowenstein jensen medium 100 gms. 54 23 / 001 / 0110 / 00 / 0 / 0 / 0 paraffin liquid ( for lab purpose ) 500ml 55 23 / 001 / 0111 / 00 / 0 / 0 / 0 phenol red ph indicator 100 ml 56 23 / 001 / 0112 / 00 / 0 / 0 / 0 nutrient broth 100 gms. 57 23 / 001 / 0113 / 00 / 0 / 0 / 0 oxidation fermentation basal media 100 gms. 58 23 / 001 / 0114 / 00 / 0 / 0 / 0 roberson cook meat medium 500 gms. 59 23 / 001 / 0115 / 00 / 0 / 0 / 0 thioglycollate medium 100 gms. 60 23 / 001 / 0116 / 00 / 0 / 0 / 0 viral transport medium 3ml vtm in 15ml tube with 2 viscos swabs 61 23 / 001 / 0117 / 00 / 0 / 0 / 0 sulphuric acid concentrated analytical grade 500ml 62 23 / 001 / 0119 / 00 / 0 / 0 / 0 tcbs agar 100gm 63 23 / 001 / 0121 / 00 / 0 / 0 / 0 thayer martin medium base with suppliments 100gm 64 23 / 001 / 0122 / 00 / 0 / 0 / 0 alkaline peptone water 100 gms. 65 23 / 001 / 0123 / 00 / 0 / 0 / 0 aesculine 5 gms. 66 23 / 001 / 0124 / 00 / 0 / 0 / 0 gentian violet powder 100 gms. 67 23 / 001 / 0125 / 00 / 0 / 0 / 0 triple sugar iron agar 100gm 68 23 / 001 / 0126 / 00 / 0 / 0 / 0 urea solution 40% ( 5ml / vial ) 69 23 / 001 / 0127 / 00 / 0 / 0 / 0 urea agar base ( christensen autoclavable ) 100gm 70 23 / 001 / 0142 / 00 / 0 / 0 / 0 phenol red dextorose broth 100gm 71 23 / 001 / 0143 / 00 / 0 / 0 / 0 phenol red lactose broth 100gm 72 23 / 001 / 0144 / 00 / 0 / 0 / 0 phenol red mannitol broth 100gm 73 23 / 001 / 0145 / 00 / 0 / 0 / 0 phenol red maltose broth 100gm 74 23 / 001 / 0146 / 00 / 0 / 0 / 0 phenol red sucrose broth 100gm 75 23 / 001 / 0147 / 00 / 0 / 0 / 0 ornithine decarboxylase broth 100gm 76 23 / 001 / 0148 / 00 / 0 / 0 / 0 lysine decarboxylase broth 100gm 77 23 / 001 / 0149 / 00 / 0 / 0 / 0 arginine decarboxylase broth 100gm 78 23 / 001 / 0152 / 00 / 0 / 0 / 0 ferrous ammonium sulphate a.r ( fe ( nh4 ) 2 so4 ) analytic grade 500 gm 79 23 / 001 / 0153 / 00 / 0 / 0 / 0 hydrogen peroxide ( h2o2 ) analytic grade 100 gm 80 23 / 001 / 0165 / 00 / 0 / 0 / 0 tri sodium citrate dihydrate analytical grade 500gm 81 23 / 001 / 0171 / 00 / 0 / 0 / 0 sodium dihydrogen orthophosphate nah2po4 2h2o ( 500 gms. ) 82 23 / 001 / 0172 / 00 / 0 / 0 / 0 disodium hydrogen orthophosphate na2hpo4 ( 500 gms. ) 83 23 / 001 / 0173 / 00 / 0 / 0 / 0 bacteriological peptone with tryptophan 500 gm 84 23 / 001 / 0174 / 00 / 0 / 0 / 0 oxacillin ( 1 micro gram ) 85 23 / 001 / 0175 / 00 / 0 / 0 / 0 vancomycin 30mcg ( individual antibiotic disc ) 86 23 / 001 / 0176 / 00 / 0 / 0 / 0 imipenam 10mcg ( individual antibiotic disc ) 87 23 / 001 / 0177 / 00 / 0 / 0 / 0 amikacin 30mcg ( individual antibiotic disc ) 88 23 / 001 / 0178 / 00 / 0 / 0 / 0 amoxy clav 30mcg ( individual antibiotic disc ) 89 23 / 001 / 0179 / 00 / 0 / 0 / 0 ammonia solution concetrated ( nh4oh ) analytical grade 500ml 90 23 / 001 / 0181 / 00 / 0 / 0 / 0 periodic acid 10gms. 91 23 / 001 / 0182 / 00 / 0 / 0 / 0 thymol crystals analytical grade 25gm 92 23 / 001 / 0183 / 00 / 0 / 0 / 0 bacitracin 93 23 / 001 / 0184 / 00 / 0 / 0 / 0 brilliant green 25 gm 94 23 / 001 / 0185 / 00 / 0 / 0 / 0 colistin 95 23 / 001 / 0192 / 00 / 0 / 0 / 0 optochin 96 23 / 001 / 0193 / 00 / 0 / 0 / 0 l phenyl alanine 100 ml 97 23 / 001 / 0194 / 00 / 0 / 0 / 0 phenol crystal 500ml 98 23 / 001 / 0195 / 00 / 0 / 0 / 0 picric acid analytical grade 500ml 99 23 / 001 / 0197 / 00 / 0 / 0 / 0 silver nitrate powder analytical grade ( ar ) 25gm 100 23 / 001 / 0198 / 00 / 0 / 0 / 0 safranine powder 25gm 101 23 / 001 / 0206 / 00 / 0 / 0 / 0 sudan black 25gm 102 23 / 001 / 0207 / 00 / 0 / 0 / 0 toluedine blue 100ml 103 23 / 001 / 0211 / 00 / 0 / 0 / 0 phenol a.r 500gm 104 23 / 001 / 0213 / 00 / 0 / 0 / 0 iodine pellet 100gm for stain preparation 105 23 / 001 / 0215 / 00 / 0 / 0 / 0 pottassium hydroxide pellet analytical grade 100gm stain prepatration 106 23 / 001 / 0218 / 00 / 0 / 0 / 0 hi chrom candida diffentrial agar, for mycology dept. 100gm 107 23 / 001 / 0219 / 00 / 0 / 0 / 0 potassium tellurite 100 gm 108 23 / 001 / 0231 / 00 / 0 / 0 / 0 methanol 2500ml 109 23 / 001 / 0234 / 00 / 0 / 0 / 0 ferric chloride anhydrous powder analytical grade 250gm 110 23 / 001 / 0235 / 00 / 0 / 0 / 0 acetic acid ( glacial ) 500ml 111 23 / 001 / 0237 / 00 / 0 / 0 / 0 potassium permangenate ar ( kmno4 ) powder 500gm 112 23 / 001 / 0238 / 00 / 0 / 0 / 0 lactophenol cotton blue 100ml 113 23 / 001 / 0244 / 00 / 0 / 0 / 0 benzidine powder analytical grade 100gm 114 23 / 001 / 0245 / 00 / 0 / 0 / 0 control for ck mb with traceability certi. human sera based 1 ml vial 115 23 / 001 / 0246 / 00 / 0 / 0 / 0 heamtoxyline powder 100gm 116 23 / 001 / 0247 / 00 / 0 / 0 / 0 mgg powder 100 gm 117 23 / 001 / 0250 / 00 / 0 / 0 / 0 sodium metabisulphite 500gm 118 23 / 001 / 0251 / 00 / 0 / 0 / 0 sodium nitroprusside 100 gm 119 23 / 001 / 0254 / 00 / 0 / 0 / 0 tuberculin p.p.d. 5tu / 0.1ml 5ml vial 120 23 / 001 / 0259 / 00 / 0 / 0 / 0 polymyxin b 300 units, required in units measurement 121 23 / 001 / 0261 / 00 / 0 / 0 / 0 tuberculin p.p.d. ( 1tu / 0.1ml ) 5ml vial 122 23 / 001 / 0264 / 00 / 0 / 0 / 0 sterile swab with plastic stick 123 23 / 001 / 0265 / 00 / 0 / 0 / 0 sterile swab with plastic stick with plastic tube 124 23 / 001 / 0266 / 00 / 0 / 0 / 0 polymyxin b 50mcg. 125 23 / 001 / 0271 / 00 / 0 / 0 / 0 spirit lamp 126 23 / 001 / 0272 / 00 / 0 / 0 / 0 n.n.n.n. tetramethyl paraphenyline diamyne dihydrochloride 5gm 127 23 / 001 / 0273 / 00 / 0 / 0 / 0 mr vp medium 100gm 128 23 / 001 / 0274 / 00 / 0 / 0 / 0 test tube rack alu. ( 15mm dia.hole size ) ( 12x4 tube cap. ) 129 23 / 001 / 0275 / 00 / 0 / 0 / 0 horse serum ( 100ml / vial ) ( use in loeflers medium base ) 130 23 / 001 / 0276 / 00 / 0 / 0 / 0 loffler medium base ( for cultivation of c diph. ) 100gm 131 23 / 001 / 0277 / 00 / 0 / 0 / 0 potassium tellurite 1% ( 1ml / vial ) 132 23 / 001 / 0278 / 00 / 0 / 0 / 0 tellurite blood agar base 100gm 133 23 / 001 / 0279 / 00 / 0 / 0 / 0 wilson blair agar base 100 gm 134 23 / 001 / 0280 / 00 / 0 / 0 / 0 wilson blair agar w / bg 100gm 135 23 / 001 / 0284 / 00 / 0 / 0 / 0 test tube stand for test tube of 40mm diameter, 150mm 136 23 / 001 / 0298 / 00 / 0 / 0 / 0 barium choride ( bacl2 ) powder analytical grade 500gm 137 23 / 001 / 0302 / 00 / 0 / 0 / 0 neutral red powder 100gm 138 23 / 001 / 0312 / 00 / 0 / 0 / 0 tween 80 analytical grade 500ml 139 23 / 001 / 0408 / 00 / 0 / 0 / 0 indicator strip for autoclave ( quality control ) pkt 25 nos. 140 23 / 001 / 0411 / 00 / 0 / 0 / 0 lab sealing film suite for all purpose parafilm 2x 250ft. ( 1dia.core ) 141 23 / 001 / 0434 / 00 / 0 / 0 / 0 tissue embedding medium ( use for frozen section in cryostate ) 100ml 142 23 / 001 / 0435 / 00 / 0 / 0 / 0 microscope bulb ( focus line ) 12v 50w 143 23 / 001 / 0436 / 00 / 0 / 0 / 0 alcohol ( molecular grade ) diluents for rna extraction / pcr test 500ml 144 23 / 001 / 0453 / 00 / 0 / 0 / 0 anti sera for vibrio cholera poly 01 145 23 / 001 / 0454 / 00 / 0 / 0 / 0 anti sera for vibrio cholera ogawa 146 23 / 001 / 0455 / 00 / 0 / 0 / 0 anti sera for vibrio cholera inaba 147 23 / 001 / 0456 / 00 / 0 / 0 / 0 anti sera for vibrio cholera o 139 148 23 / 001 / 0457 / 00 / 0 / 0 / 0 anti sera for salmonella spp poly o 149 23 / 001 / 0458 / 00 / 0 / 0 / 0 anti sera for salmonella spp o 9 150 23 / 001 / 0459 / 00 / 0 / 0 / 0 anti sera for salmonella spp h d 151 23 / 001 / 0460 / 00 / 0 / 0 / 0 anti sera for salmonella spp h a 152 23 / 001 / 0461 / 00 / 0 / 0 / 0 anti sera for salmonella spp h b 153 23 / 001 / 0462 / 00 / 0 / 0 / 0 anti sera for salmonella spp v i 154 23 / 001 / 0463 / 00 / 0 / 0 / 0 basic fusching powder 500gm 155 23 / 001 / 0509 / 00 / 0 / 0 / 0 disposable s.s. microtome blade for leica microtome rm2255 box of 35no 156 23 / 001 / 0525 / 00 / 0 / 0 / 0 cefoxitin 30mcg ( individual antibiotic disc ) 157 23 / 001 / 0526 / 00 / 0 / 0 / 0 cefazolin 30mcg ( individual antibiotic disc ) 158 23 / 001 / 0527 / 00 / 0 / 0 / 0 cefuroxime 30mcg ( individual antibiotic disc ) 159 23 / 001 / 0528 / 00 / 0 / 0 / 0 teicoplanin 30mcg ( individual antibiotic disc ) 160 23 / 001 / 0529 / 00 / 0 / 0 / 0 linezolid 30mcg ( individual antibiotic disc ) 161 23 / 001 / 0530 / 00 / 0 / 0 / 0 levofloxacin 5mcg ( individual antibiotic disc ) 162 23 / 001 / 0531 / 00 / 0 / 0 / 0 erythromycin 15mcg ( individual antibiotic disc ) 163 23 / 001 / 0532 / 00 / 0 / 0 / 0 ampicillin 10 units ( individual antibiotic disc ) 164 23 / 001 / 0533 / 00 / 0 / 0 / 0 co trimoxazole 25mcg ( individual antibiotic disc ) 165 23 / 001 / 0534 / 00 / 0 / 0 / 0 gentamicin 10mcg ( individual antibiotic disc ) 166 23 / 001 / 0535 / 00 / 0 / 0 / 0 piperacillin / tazobactam 100 / 10mcg ( individual antibiotic disc ) 167 23 / 001 / 0536 / 00 / 0 / 0 / 0 tobramycin 10mcg ( individual antibiotic disc ) 168 23 / 001 / 0537 / 00 / 0 / 0 / 0 norfloxacin 10mcg ( individual antibiotic disc ) 169 23 / 001 / 0538 / 00 / 0 / 0 / 0 lomefloxacin 10mcg ( individual antibiotic disc ) 170 23 / 001 / 0539 / 00 / 0 / 0 / 0 gatifloxacin 5mcg ( individual antibiotic disc ) 171 23 / 001 / 0540 / 00 / 0 / 0 / 0 nitrofurantoin 300mcg ( individual antibiotic disc ) 172 23 / 001 / 0541 / 00 / 0 / 0 / 0 tetracycline 30mcg ( individual antibiotic disc ) 173 23 / 001 / 0542 / 00 / 0 / 0 / 0 netilin 30mcg ( individual antibiotic disc ) 174 23 / 001 / 0543 / 00 / 0 / 0 / 0 ceftizoxime 30mcg ( individual antibiotic disc ) 175 23 / 001 / 0544 / 00 / 0 / 0 / 0 meropenem 10mcg ( individual antibiotic disc ) 176 23 / 001 / 0547 / 00 / 0 / 0 / 0 bilirubin powder ar ( analytical grade ) 5 gm 177 23 / 001 / 0548 / 00 / 0 / 0 / 0 copper acetate ( analytical grade ) 500 gm 178 23 / 001 / 0549 / 00 / 0 / 0 / 0 diethyl ether ar 2500ml 179 23 / 001 / 0586 / 00 / 0 / 0 / 0 factor viii deficient plasma 5x1 ml 180 23 / 001 / 0587 / 00 / 0 / 0 / 0 red cell preservative solution ( 20ml vial ) 181 23 / 001 / 0611 / 00 / 0 / 0 / 0 amonium bromide lr 250 gm 182 23 / 001 / 0612 / 00 / 0 / 0 / 0 emb agar 100 gms 183 23 / 001 / 0614 / 00 / 0 / 0 / 0 capsule stain, for capsule staining of bacteria 100 ml 184 23 / 001 / 0615 / 00 / 0 / 0 / 0 spore stain kit, for spore staining of bacteria, kit of 100 ml 185 23 / 001 / 0616 / 00 / 0 / 0 / 0 macfarlands standard 0.5, for antimicrobial sensitivity test, set 5 tube 186 23 / 001 / 0617 / 00 / 0 / 0 / 0 spirochaetes stain / fontana stain, kit of 200 ml 187 23 / 001 / 0618 / 00 / 0 / 0 / 0 motility test medium 100 gms 188 23 / 001 / 0619 / 00 / 0 / 0 / 0 eosin methylene blue medium 100 gms 189 23 / 001 / 0620 / 00 / 0 / 0 / 0 ertrapenam antibiotic disc, antibio. disc individul with content 10mcg 190 23 / 001 / 0621 / 00 / 0 / 0 / 0 ceftazidime / clavulanic acid antibiotic disc 191 23 / 001 / 0622 / 00 / 0 / 0 / 0 chloramphenicol antibiotic disc, individual with content 30mcg 192 23 / 001 / 0623 / 00 / 0 / 0 / 0 tigecycline antibiotic disc individual with content 15mcg 193 23 / 001 / 0624 / 00 / 0 / 0 / 0 nitrate disc for nitrate reduction test 194 23 / 001 / 0625 / 00 / 0 / 0 / 0 bile esculine disc for detection of esculin hydrolisis 195 23 / 001 / 0626 / 00 / 0 / 0 / 0 mrsa chrome agar base 500gms, for detection of mrsa 196 23 / 001 / 0628 / 00 / 0 / 0 / 0 cefoxitin suppliment, for preparation of mrsa agar 197 23 / 001 / 0629 / 00 / 0 / 0 / 0 serum controls for ra latex, for quality control, vial of 0.5ml 198 23 / 001 / 0630 / 00 / 0 / 0 / 0 serum controls for aso latex, for quality control, vial of 0.5ml 199 23 / 001 / 0631 / 00 / 0 / 0 / 0 serum controls for crp latex, for quality control, vial of 0.5ml 200 23 / 001 / 0632 / 00 / 0 / 0 / 0 serum controls for rpr, for quality control, vial of 0.5ml 201 23 / 001 / 0633 / 00 / 0 / 0 / 0 serum controls for widal, for quality control, vial of 0.5ml 202 23 / 001 / 0634 / 00 / 0 / 0 / 0 external positive control for 203 23 / 001 / 0787 / 00 / 0 / 0 / 0 fine salt ( nacl / sodium chloride ) 500gm 204 23 / 001 / 0794 / 00 / 0 / 0 / 0 sodium hypochlorite lr 500ml 205 23 / 001 / 0832 / 00 / 0 / 0 / 0 anti c antisera ( monoclonal 206 23 / 001 / 0833 / 00 / 0 / 0 / 0 anti c antisera ( monoclonal ) 207 23 / 001 / 0834 / 00 / 0 / 0 / 0 anti e antisera ( monoclonal ) 208 23 / 001 / 0835 / 00 / 0 / 0 / 0 anti e antisera ( monoclonal ) 209 23 / 001 / 0839 / 00 / 0 / 0 / 0 gram ve common antibiotic discs ( 120 mm sized plate ) 210 23 / 001 / 0840 / 00 / 0 / 0 / 0 gram ve special antibiotic discs for 90 mm sized plate 211 23 / 001 / 0841 / 00 / 0 / 0 / 0 gram +ve common antibiotic discs for 120 mm sized plate 212 23 / 001 / 0842 / 00 / 0 / 0 / 0 gram +ve cocci special discs ( 90 mm sized plate ) 213 23 / 001 / 0843 / 00 / 0 / 0 / 0 pseudomonas antibiotic discs ( 120 mm sized plate ) 214 23 / 001 / 0844 / 00 / 0 / 0 / 0 enterococci special discs ( 90 mm sized plate ) 215 23 / 001 / 0845 / 00 / 0 / 0 / 0 thymol 50 gm 216 23 / 001 / 0846 / 00 / 0 / 0 / 0 phenol 10% water 500 ml 217 23 / 001 / 0847 / 00 / 0 / 0 / 0 coarse salt ( nacl ) lr 25 kg. 218 23 / 001 / 0848 / 00 / 0 / 0 / 0 dna zap spray 250ml, completely degrades contaminating dna&rna level 219 23 / 002 / 0001 / 00 / 0 / 0 / 0 double deionized water nccls type jar of 5 liter 220 23 / 002 / 0002 / 00 / 0 / 0 / 0 acetone liquid lr 2500ml 221 23 / 002 / 0003 / 00 / 0 / 0 / 0 chloroform 500ml 222 23 / 002 / 0006 / 00 / 0 / 0 / 0 ammonium molybdate powder 500 gms. 223 23 / 002 / 0007 / 00 / 0 / 0 / 0 xylene sulfar free 2500ml 224 23 / 002 / 0008 / 00 / 0 / 0 / 0 barium chloride powder lr 500gm 225 23 / 002 / 0009 / 00 / 0 / 0 / 0 barium chloride solution 500ml 226 23 / 002 / 0010 / 00 / 0 / 0 / 0 edta powder dipottasium salt ( bsc certified ar ) 500gm 227 23 / 002 / 0011 / 00 / 0 / 0 / 0 edta powder disodium salt 500 gms. 228 23 / 002 / 0012 / 00 / 0 / 0 / 0 concentrated hydrochloric acid analytical grade 500ml 229 23 / 002 / 0013 / 00 / 0 / 0 / 0 hydrogen peroxide 6% 500ml 230 23 / 002 / 0016 / 00 / 0 / 0 / 0 chromic acid reagent 100ml 231 23 / 002 / 0018 / 00 / 0 / 0 / 0 immersion oil for microscope ceder wood oil 500ml 232 23 / 002 / 0019 / 00 / 0 / 0 / 0 isopropanol sq 2500ml 233 23 / 002 / 0021 / 00 / 0 / 0 / 0 ammonium sulphate analytical grade 500gm 234 23 / 002 / 0023 / 00 / 0 / 0 / 0 light green sf powder 25 gms. 235 23 / 002 / 0024 / 00 / 0 / 0 / 0 copper sulphate analytical grade 500gm 236 23 / 002 / 0028 / 00 / 0 / 0 / 0 eosin y powder 25 gms 237 23 / 002 / 0029 / 00 / 0 / 0 / 0 di sodium hydrogen phosphate ( anhydrous ) 500gm 238 23 / 002 / 0032 / 00 / 0 / 0 / 0 naphthalene nitrate 1 kg 239 23 / 002 / 0033 / 00 / 0 / 0 / 0 borax 1kg. 240 23 / 002 / 0034 / 00 / 0 / 0 / 0 glycerol 5 liter jar 241 23 / 002 / 0038 / 00 / 0 / 0 / 0 hydrogen peroxide 30% w / v lr 500ml 242 23 / 002 / 0043 / 00 / 0 / 0 / 0 lactose monohydrate analytical grade 500gm 243 23 / 002 / 0045 / 00 / 0 / 0 / 0 potassium alum powder ( haematoxylin stain preparation ) 500 gms. 244 23 / 002 / 0046 / 00 / 0 / 0 / 0 maltose monohydrate analytical grade 500gm 245 23 / 002 / 0052 / 00 / 0 / 0 / 0 phenolphthalein powder 100 gms. 246 23 / 002 / 0060 / 00 / 0 / 0 / 0 sodium chloride powder analytical grade 500gm for ihc / for cell wash 247 23 / 002 / 0063 / 00 / 0 / 0 / 0 sodium hydroxide pellets analytical grade 500gm 248 23 / 002 / 0068 / 00 / 0 / 0 / 0 sodium thiosulphate anhydrous 500gm, use for prepare reticulin stain 249 23 / 002 / 0069 / 00 / 0 / 0 / 0 hematin powder ( ptah stain ) 5 gms. 250 23 / 002 / 0071 / 00 / 0 / 0 / 0 tris buffer 99% pure grade 500 gms. 251 23 / 002 / 0075 / 00 / 0 / 0 / 0 disposable micro tips for auto pipetes ( 1 20 ul ) 252 23 / 002 / 0076 / 00 / 0 / 0 / 0 molecular water, molecular grade, nuclease free water 500ml 253 23 / 002 / 0078 / 00 / 0 / 0 / 0 serum vial storage box, capacity of box is 96 nos.of 2 ml vial 254 23 / 002 / 0085 / 00 / 0 / 0 / 0 wooden stick 255 23 / 002 / 0086 / 00 / 0 / 0 / 0 sterile plastic graduated 15ml centrifuge tube conical polypropylene 256 23 / 002 / 0087 / 00 / 0 / 0 / 0 imipenam / edta 10 / 750 mcg ( single disc ) for research work ( botl 50 disc ) 257 23 / 002 / 0088 / 00 / 0 / 0 / 0 cefoperazone / sulbactam 75 / 30 ug ( single disc ) for research, pack of 50 258 23 / 002 / 0089 / 00 / 0 / 0 / 0 gentamicin for hlar 120ug ( single disc ) 259 23 / 002 / 0090 / 00 / 0 / 0 / 0 hexa antimyco antifungal disc ( 6 ) ( for antifungal sensitivity test 260 23 / 002 / 0091 / 00 / 0 / 0 / 0 doxycycline 30mcg disc, for routine lab. work ( pack of 100disc ) 261 23 / 002 / 0094 / 00 / 0 / 0 / 0 amber coloured glass dropping bottle 125ml 262 23 / 002 / 0095 / 00 / 0 / 0 / 0 fluconazole ( 25 ug ) antifungal single disc 263 23 / 002 / 0096 / 00 / 0 / 0 / 0 voriconazole ( 1 ug ) for antifungal sensitivity testing disc, pack of50 264 23 / 002 / 0098 / 00 / 0 / 0 / 0 aluminium foil 72 metre x 30cm, 11 micron thickness 265 23 / 002 / 0099 / 00 / 0 / 0 / 0 permanent marker pen ( thin pointed ) 266 23 / 002 / 0100 / 00 / 0 / 0 / 0 glass marking pencil 267 23 / 002 / 0101 / 00 / 0 / 0 / 0 sabourds dextrose broth 100 gm 268 23 / 002 / 0102 / 00 / 0 / 0 / 0 bromocresol purple 5 gm 269 23 / 002 / 0103 / 00 / 0 / 0 / 0 amphotericin b ( 50mcg ) antifungal drugs 270 23 / 002 / 0104 / 00 / 0 / 0 / 0 clotrimazole ( 10mcg ) antifungal drugs 271 23 / 002 / 0105 / 00 / 0 / 0 / 0 fluconazole ( 10mcg ) antifungal drugs 272 23 / 002 / 0106 / 00 / 0 / 0 / 0 itraconazole ( 30mcg ) antifungal drugs 273 23 / 002 / 0107 / 00 / 0 / 0 / 0 ketokonazole ( 30mcg ) antifungal drugs 274 23 / 002 / 0108 / 00 / 0 / 0 / 0 miconazole ( 50mcg ) antifungal drugs 275 23 / 002 / 0109 / 00 / 0 / 0 / 0 nystatin ( 100 units ) antifungal drugs 276 23 / 002 / 0110 / 00 / 0 / 0 / 0 galactose carbohydrate discs 277 23 / 002 / 0111 / 00 / 0 / 0 / 0 maltose carbohydrate discs 278 23 / 002 / 0112 / 00 / 0 / 0 / 0 sucrose carbohydrate discs 279 23 / 002 / 0113 / 00 / 0 / 0 / 0 lactose carbohydrate discs 280 23 / 002 / 0114 / 00 / 0 / 0 / 0 trehalose carbohydrate discs 281 23 / 002 / 0115 / 00 / 0 / 0 / 0 cellobiose carbohydrate discs 282 23 / 002 / 0116 / 00 / 0 / 0 / 0 raffinose carbohydrate discs 283 23 / 002 / 0117 / 00 / 0 / 0 / 0 mellbiose carbohydrate discs 284 23 / 002 / 0118 / 00 / 0 / 0 / 0 dulcitol carbohydrate discs 285 23 / 002 / 0119 / 00 / 0 / 0 / 0 dextrose carbohydrate discs 286 23 / 002 / 0120 / 00 / 0 / 0 / 0 inositol carbohydrate discs 287 23 / 002 / 0121 / 00 / 0 / 0 / 0 xylose carbohydrate discs 288 23 / 002 / 0127 / 00 / 0 / 0 / 0 carbenicillin 100mcg ( individual antibiotic disc ) 289 23 / 002 / 0128 / 00 / 0 / 0 / 0 piperacillin 100mcg ( individual antibiotic disc ) 290 23 / 002 / 0129 / 00 / 0 / 0 / 0 ticarcillin 75mcg ( individual antibiotic disc ) 291 23 / 002 / 0130 / 00 / 0 / 0 / 0 ciprofloxacin 5mcg ( individual antibiotic disc ) 292 23 / 002 / 0131 / 00 / 0 / 0 / 0 cefepime 30mcg ( individual antibiotic disc ) 293 23 / 002 / 0132 / 00 / 0 / 0 / 0 cefoparazone 75mcg ( individual antibiotic disc ) 294 23 / 002 / 0133 / 00 / 0 / 0 / 0 ceftazidime 30 unit ( individual antibiotic disc ) 295 23 / 002 / 0134 / 00 / 0 / 0 / 0 ceftriaxon ( 30 mcg ) antibiotic sensitivity disc 296 23 / 002 / 0135 / 00 / 0 / 0 / 0 novobiocin 5mcg ( antibiotic sensitivity disc ) 297 23 / 002 / 0136 / 00 / 0 / 0 / 0 atcc strain e. coli 25922 298 23 / 002 / 0137 / 00 / 0 / 0 / 0 atcc strain pseudomonas aeruginosa 27853 299 23 / 002 / 0138 / 00 / 0 / 0 / 0 atcc strain staph aureus 25923 300 23 / 002 / 0139 / 00 / 0 / 0 / 0 thioglycollate brothe 500 gm 301 23 / 002 / 0140 / 00 / 0 / 0 / 0 dnase test agar base 500 gm 302 23 / 002 / 0141 / 00 / 0 / 0 / 0 bile esculin agar 100gm 303 23 / 002 / 0142 / 00 / 0 / 0 / 0 sabourds dextrose cycloheximide chlormphenicol agar 100gm 304 23 / 002 / 0143 / 00 / 0 / 0 / 0 mannitol salt agar 100gm 305 23 / 002 / 0151 / 00 / 0 / 0 / 0 bromocresol green 5gm 306 23 / 002 / 0153 / 00 / 0 / 0 / 0 ninhydrin powder ar 25 gm 307 23 / 002 / 0157 / 00 / 0 / 0 / 0 chlorophenol red 5 gm 308 23 / 002 / 0164 / 00 / 0 / 0 / 0 dipotasium hydrogen phosphate powder 500gm 309 23 / 002 / 0165 / 00 / 0 / 0 / 0 sodium dihydrogen phosphate 500 gm 310 23 / 002 / 0166 / 00 / 0 / 0 / 0 celestain blue powder 500 gm 311 23 / 002 / 0179 / 00 / 0 / 0 / 0 polymer kit for ihc dab, buffer and secondary antibody 312 23 / 002 / 0180 / 00 / 0 / 0 / 0 estrogen receptor for ihc 313 23 / 002 / 0181 / 00 / 0 / 0 / 0 progesterone receptor for ihc 314 23 / 002 / 0182 / 00 / 0 / 0 / 0 her 2 neu ( c erbb2 ) for ihc 315 23 / 002 / 0183 / 00 / 0 / 0 / 0 pancytokeratin for ihc 316 23 / 002 / 0184 / 00 / 0 / 0 / 0 s 100 for ihc 317 23 / 002 / 0185 / 00 / 0 / 0 / 0 chromogranin for ihc 318 23 / 002 / 0186 / 00 / 0 / 0 / 0 cd 30 for ihc 319 23 / 002 / 0187 / 00 / 0 / 0 / 0 cea for ihc 320 23 / 002 / 0188 / 00 / 0 / 0 / 0 bel 2 for ihc 321 23 / 002 / 0189 / 00 / 0 / 0 / 0 cd 99 for ihc 322 23 / 002 / 0190 / 00 / 0 / 0 / 0 vimentin for ihc 323 23 / 002 / 0191 / 00 / 0 / 0 / 0 cd3 for ihc 324 23 / 002 / 0192 / 00 / 0 / 0 / 0 cd20 for ihc 325 23 / 002 / 0193 / 00 / 0 / 0 / 0 cd5 for ihc 326 23 / 002 / 0194 / 00 / 0 / 0 / 0 leucocyte common antigen ( lca / cd45 ) for ihc 327 23 / 002 / 0195 / 00 / 0 / 0 / 0 smooth muscle actin ( sma ) for ihc 328 23 / 002 / 0196 / 00 / 0 / 0 / 0 hmb 45 for ihc 329 23 / 002 / 0197 / 00 / 0 / 0 / 0 cd117 for ihc 330 23 / 002 / 0198 / 00 / 0 / 0 / 0 desmin for ihc 331 23 / 002 / 0199 / 00 / 0 / 0 / 0 tris buffer powder for ihc 500 gm 332 23 / 002 / 0200 / 00 / 0 / 0 / 0 citric acid anhydrous for ihc 500 gms. 333 23 / 002 / 0201 / 00 / 0 / 0 / 0 poly l lysine for ihc 334 23 / 002 / 0202 / 00 / 0 / 0 / 0 atcc candida albicans control stain ( for candida isolation ) 335 23 / 002 / 0203 / 00 / 0 / 0 / 0 neuron specific enolase ihc marker ( ready to use ) 336 23 / 002 / 0204 / 00 / 0 / 0 / 0 calcitonin ihc marker ( ready to use ) 337 23 / 002 / 0205 / 00 / 0 / 0 / 0 prostate specific antigen ihc marker ( ready to use ) 338 23 / 002 / 0206 / 00 / 0 / 0 / 0 synaptophysin ihc marker ( ready to use ) 339 23 / 002 / 0208 / 00 / 0 / 0 / 0 hep par 1 ( ready to use ) 340 23 / 002 / 0209 / 00 / 0 / 0 / 0 tdt ( ready to use ) 341 23 / 002 / 0210 / 00 / 0 / 0 / 0 ttf1 ( ready to use ) 342 23 / 002 / 0211 / 00 / 0 / 0 / 0 napsin ( ready to use ) 343 23 / 002 / 0212 / 00 / 0 / 0 / 0 p63 ( ready to use ) 344 23 / 002 / 0213 / 00 / 0 / 0 / 0 c kit ( ready to use ) 345 23 / 002 / 0215 / 00 / 0 / 0 / 0 ck20 ( ready to use ) 346 23 / 002 / 0216 / 00 / 0 / 0 / 0 cd34 ( ready to use ) 347 23 / 002 / 0217 / 00 / 0 / 0 / 0 ck5 / 6 ( ready to use ) 348 23 / 002 / 0218 / 00 / 0 / 0 / 0 ki 67 ag ( mib 1 ) ready to use for ihc 349 23 / 002 / 0219 / 00 / 0 / 0 / 0 ema ( epithalial membron ag ) ready to use, for ihc in diagno. histopatho 350 23 / 002 / 0220 / 00 / 0 / 0 / 0 cd68 ready to use reagent, for ihc in diagno. histopathology 351 23 / 002 / 0221 / 00 / 0 / 0 / 0 cd31 ready to use reagent, for ihc in diagno. histopathology 352 23 / 002 / 0222 / 00 / 0 / 0 / 0 calretinin ready to use reagent, for ihc in diagno. histopathology 353 23 / 002 / 0223 / 00 / 0 / 0 / 0 cd15 ready to use reagent, for ihc in diagno. histopathology 354 23 / 002 / 0224 / 00 / 0 / 0 / 0 anginase 1ready to use reagent, for ihc in diagno. histopathology 355 23 / 002 / 0225 / 00 / 0 / 0 / 0 glipican 3 ready to use reagent, for ihc in diagno. histopathology 356 23 / 002 / 0226 / 00 / 0 / 0 / 0 ck 19 ready to use reagent, for ihc in diagno. histopathology 357 23 / 002 / 0227 / 00 / 0 / 0 / 0 moc31 ( eplam ) ready to use reagent, for ihc in diagno. histopathology 358 23 / 002 / 0228 / 00 / 0 / 0 / 0 pax 2 or pax 8 ready to use reagent, for ihc in diagno. histopatho 359 23 / 004 / 0001 / 00 / 0 / 0 / 0 haemoglobin stirrer 360 23 / 004 / 0002 / 00 / 0 / 0 / 0 haemoglobin pipette 0.2% 361 23 / 004 / 0003 / 00 / 0 / 0 / 0 haemoglobin tube square ( 14.5 gm=100% ) 362 23 / 004 / 0004 / 00 / 0 / 0 / 0 wintrobe tube 363 23 / 004 / 0005 / 00 / 0 / 0 / 0 tips box ( 50 200 ul tips ) 364 23 / 004 / 0006 / 00 / 0 / 0 / 0 esrite pipettes 365 23 / 004 / 0007 / 00 / 0 / 0 / 0 cover slip for w.b.c.count box of 20 packets 366 23 / 004 / 0010 / 00 / 0 / 0 / 0 durhams tube 367 23 / 004 / 0011 / 00 / 0 / 0 / 0 sheep blood agar plate disposable 368 23 / 004 / 0012 / 00 / 0 / 0 / 0 measuring cylinder 250 ml plastic autoclavable 369 23 / 004 / 0013 / 00 / 0 / 0 / 0 measuring cylinder 500 ml plastic autoclavable 370 23 / 004 / 0014 / 00 / 0 / 0 / 0 measuring cylinder 1000 ml plastic autoclavable 371 23 / 004 / 0015 / 00 / 0 / 0 / 0 beaker with spout 50 ml borosilicate glass 372 23 / 004 / 0017 / 00 / 0 / 0 / 0 petri dish 100mm plastic autoclavable 373 23 / 004 / 0019 / 00 / 0 / 0 / 0 sterile plastic petri dish ( disposable ) ( 90mm ) for routine lab. work 374 23 / 004 / 0022 / 00 / 0 / 0 / 0 improved neubers chamber standard quality 375 23 / 004 / 0025 / 00 / 0 / 0 / 0 plain bulb with labled and rubber cap 10ml capacity 376 23 / 004 / 0026 / 00 / 0 / 0 / 0 pap pen used for marking on ihc slides 377 23 / 004 / 0027 / 00 / 0 / 0 / 0 glass trough with lid for staining slides 150 x 110 x 70 mm 378 23 / 004 / 0028 / 00 / 0 / 0 / 0 spreader slides packet of 10 nos. 379 23 / 004 / 0029 / 00 / 0 / 0 / 0 petri dish plastic ( disposable ) 90 mm 380 23 / 004 / 0031 / 00 / 0 / 0 / 0 cover glasses 18mm square ( thin no.1 ) box of 20 packets 381 23 / 004 / 0032 / 00 / 0 / 0 / 0 glass museum jar with lid ( cover ) big ( 30*20*10 ) cm3 382 23 / 004 / 0033 / 00 / 0 / 0 / 0 glass museum jar with lid ( cover ) big ( 25*15*10 ) cm3 383 23 / 004 / 0034 / 00 / 0 / 0 / 0 glass museum jar with lid square ( 20*20*10 ) cm3 384 23 / 004 / 0035 / 00 / 0 / 0 / 0 glass museum jar with lid square ( 20*20*15 ) cm3 385 23 / 004 / 0036 / 00 / 0 / 0 / 0 glass museum jar with lid square ( 20*15*10 ) cm3 386 23 / 004 / 0037 / 00 / 0 / 0 / 0 glass museum jar with lid small ( 15*10*5 ) cm3 387 23 / 004 / 0038 / 00 / 0 / 0 / 0 glass museum jar with lid very small ( 10*5*5 ) cm3 388 23 / 004 / 0039 / 00 / 0 / 0 / 0 edta bulb with labled and rubber cap 5ml capacity 389 23 / 004 / 0042 / 00 / 0 / 0 / 0 beaker with spout 100ml borosilicate glass 390 23 / 004 / 0044 / 00 / 0 / 0 / 0 beaker with spout 500ml borosilicate glass 391 23 / 004 / 0045 / 00 / 0 / 0 / 0 beaker with spout 1000ml borosilicate glass 392 23 / 004 / 0048 / 00 / 0 / 0 / 0 cryo vial 2ml external thread free standing molecular grade 393 23 / 004 / 0049 / 00 / 0 / 0 / 0 nitrile gloves molecular grade size: s / 6.5, m / 7.0. l / 7.5 394 23 / 004 / 0051 / 00 / 0 / 0 / 0 measuring cylinder 250ml borosilicate glass 395 23 / 004 / 0052 / 00 / 0 / 0 / 0 measuring cylinder 500ml borosilicate glass 396 23 / 004 / 0054 / 00 / 0 / 0 / 0 acrylic museum jar with lid small ( 15*15*10 ) cm 397 23 / 004 / 0055 / 00 / 0 / 0 / 0 acrylic museum jar with lid medium ( 20*15*10 ) cm 398 23 / 004 / 0056 / 00 / 0 / 0 / 0 blood culture glass bottle 399 23 / 004 / 0057 / 00 / 0 / 0 / 0 filter paper no.9 ( 90 mm ) box of 100 nos. 400 23 / 004 / 0059 / 00 / 0 / 0 / 0 brain heart infusion broth 500gm 401 23 / 004 / 0061 / 00 / 0 / 0 / 0 phenylalanine agar m281 100gm 402 23 / 004 / 0062 / 00 / 0 / 0 / 0 cled agar 100gm 403 23 / 004 / 0065 / 00 / 0 / 0 / 0 cary blair medium 100gm 404 23 / 004 / 0066 / 00 / 0 / 0 / 0 stuarts transport medium 100gm 405 23 / 004 / 0067 / 00 / 0 / 0 / 0 x.l.d. agar 100gm 406 23 / 004 / 0069 / 00 / 0 / 0 / 0 selenite f broth 100gm 407 23 / 004 / 0078 / 00 / 0 / 0 / 0 blood culture bottle with bhi with 0.05 sps 70ml 408 23 / 004 / 0079 / 00 / 0 / 0 / 0 blood culture bottle with bhi with 0.05 sps 20ml 409 23 / 004 / 0080 / 00 / 0 / 0 / 0 beaker 1000ml ( autoclavable plastic ) 410 23 / 004 / 0081 / 00 / 0 / 0 / 0 beaker 500ml ( autoclavable plastic ) 411 23 / 004 / 0082 / 00 / 0 / 0 / 0 beaker 250ml ( autoclavable plastic ) 412 23 / 004 / 0083 / 00 / 0 / 0 / 0 dreyers tubes for widal test 413 23 / 004 / 0084 / 00 / 0 / 0 / 0 felix tubes for widal test 414 23 / 004 / 0087 / 00 / 0 / 0 / 0 beaker borosilicate 2 ltr. 415 23 / 004 / 0089 / 00 / 0 / 0 / 0 measuring cylinder 25ml borosicate glass 416 23 / 004 / 0092 / 00 / 0 / 0 / 0 urine collection jar conical 417 23 / 004 / 0093 / 00 / 0 / 0 / 0 volumetric flask 100ml 418 23 / 004 / 0094 / 00 / 0 / 0 / 0 volumetric flask 500ml 419 23 / 004 / 0097 / 00 / 0 / 0 / 0 microscope helogen bulb 6v, 30w 420 23 / 004 / 0099 / 00 / 0 / 0 / 0 pipette 10ml graduated borosilicate glass 421 23 / 004 / 0101 / 00 / 0 / 0 / 0 dropper borosilicate 422 23 / 004 / 0105 / 00 / 0 / 0 / 0 multichannel micropipette 100 1000ul variable ( for washin elisa ) 423 23 / 004 / 0107 / 00 / 0 / 0 / 0 antibiotic disc dispensor 8 position antibiotic single disc 424 23 / 004 / 0108 / 00 / 0 / 0 / 0 aluminium horizontal tray ( strong, good quality, to hold 20 slide ) 425 23 / 004 / 0111 / 00 / 0 / 0 / 0 filter cards ( thick white ) with 01 hole ( for cytospin 4 ) 426 23 / 004 / 0118 / 00 / 0 / 0 / 0 chart paper 10c to +40c for penpole comp. 2c to 6c freeze 427 23 / 004 / 0119 / 00 / 0 / 0 / 0 chart paper +50c to 100c for penpole comp. 40c to 80c freeze 428 23 / 004 / 0120 / 00 / 0 / 0 / 0 chart paper 10c to +40c for remi company 2c to 6c freeze 429 23 / 004 / 0121 / 00 / 0 / 0 / 0 chart paper 10c to +40c for haier comp. 2c to 6c freeze 430 23 / 004 / 0124 / 00 / 0 / 0 / 0 sample cup large size for biochemistry dept. 431 23 / 004 / 0125 / 00 / 0 / 0 / 0 sample cup small size for biochemistry dept. 432 23 / 004 / 0126 / 00 / 0 / 0 / 0 eppendroff tube ( alliquote ) 2.5ml 433 23 / 004 / 0127 / 00 / 0 / 0 / 0 printer paper roll 57mm x 25 meter 434 23 / 004 / 0129 / 00 / 0 / 0 / 0 chart paper +50c to 100c, 6 size, round for haier, deep freeze 40c& 80c 435 23 / 004 / 0137 / 00 / 0 / 0 / 0 thermograph marker pen, fibre tip pen, red, 06mm size 436 23 / 004 / 0138 / 00 / 0 / 0 / 0 aluminium cap for blood culture bottle sealing 20mm diameter 437 23 / 004 / 0141 / 00 / 0 / 0 / 0 ph paper strip ( 0 to 14.0 ) 100 strip 438 23 / 004 / 0142 / 00 / 0 / 0 / 0 ph paper strip ( 6.5 to 10.0 ) 100 strip 439 23 / 004 / 0193 / 00 / 0 / 0 / 0 eppendorf tube 1.5ml non binding polypropelene tube, molecular grade 440 23 / 004 / 0194 / 00 / 0 / 0 / 0 200ul tip w / o filter molecular grade, dnase rnase free loose pack 441 23 / 004 / 0195 / 00 / 0 / 0 / 0 300ul tip w / o filter molecular grade, dnase rnase free loose pack 442 23 / 004 / 0196 / 00 / 0 / 0 / 0 1000ul tip w / o filter molecular grade, dnase rnase free loose pack 443 23 / 004 / 0197 / 00 / 0 / 0 / 0 filter tips 10ul filter barrier tips, molecular grade, dnase rnase free 444 23 / 004 / 0198 / 00 / 0 / 0 / 0 filter tips 20ul, filter barrier tips, molecular grade, dnase rnase free 445 23 / 004 / 0199 / 00 / 0 / 0 / 0 filter tips 200ul, filter barrier tips, molecular grade, dnase rnase free 446 23 / 004 / 0200 / 00 / 0 / 0 / 0 filter tip 1000ul filter barrier tip, molecular grade dnase rnase free 447 23 / 004 / 0208 / 00 / 0 / 0 / 0 filter barrier tip ( 100ul ) with filter, molecular grade dnase rnase free 448 23 / 004 / 0209 / 00 / 0 / 0 / 0 filter barier tip ( 0.2 1.0ul ) with filter, molecular grade dnase rnase 449 23 / 004 / 0210 / 00 / 0 / 0 / 0 multipurpose plastic rack for vtm & other different size tubes 450 23 / 004 / 0211 / 00 / 0 / 0 / 0 microcentrifuge tube rack, benchtop for efficient processing, 451 23 / 005 / 0001 / 00 / 0 / 0 / 0 esrite sample filling plastic vials 452 23 / 005 / 0009 / 00 / 0 / 0 / 0 disposable tips small ( 0 200ul ) packet of 1000 nos. 453 23 / 005 / 0011 / 00 / 0 / 0 / 0 melting point capillary ( packet of 100 numbers ) 454 23 / 005 / 0012 / 00 / 0 / 0 / 0 turnicate tube 455 23 / 005 / 0018 / 00 / 0 / 0 / 0 lancet needle, disposable, sterile, s.s. material 456 23 / 005 / 0025 / 00 / 0 / 0 / 0 nichrome loop with handle 24 gauze changeble nichrome loop 457 23 / 005 / 0026 / 00 / 0 / 0 / 0 nichrome wire with handle 24 gauze changeble nichrome wire 458 23 / 005 / 0027 / 00 / 0 / 0 / 0 nichrome wire 24 gauze 459 23 / 005 / 0028 / 00 / 0 / 0 / 0 nichrome loop 24 gauze 460 23 / 005 / 0030 / 00 / 0 / 0 / 0 hb. meter ( hb estimation ) prismatic square tube with accessories 461 23 / 005 / 0031 / 00 / 0 / 0 / 0 sterilized plas.container for urine & sputum wide mouth cap. 100ml 462 23 / 005 / 0033 / 00 / 0 / 0 / 0 sterilized screw capped universal plastic container cap. 50ml 463 23 / 005 / 0035 / 00 / 0 / 0 / 0 plastic dropper for sample taking 464 23 / 005 / 0036 / 00 / 0 / 0 / 0 polytube ( ria vial ) 12x75mm ( polyurethane tube non stick material ) 465 23 / 005 / 0041 / 00 / 0 / 0 / 0 urine collection flask plastic ( 10ml capacity ) 466 23 / 005 / 0042 / 00 / 0 / 0 / 0 coplin jar ( plas. ) with cover stain purpose 30ml capacity 467 23 / 005 / 0044 / 00 / 0 / 0 / 0 couplin jar 100 ml borosilicate glass 468 23 / 005 / 0045 / 00 / 0 / 0 / 0 turnicate belt 469 23 / 005 / 0050 / 00 / 0 / 0 / 0 microscope objectives imported, highpower lence 45x 470 23 / 005 / 0053 / 00 / 0 / 0 / 0 band aid spot 22mm diameter 471 23 / 005 / 0058 / 00 / 0 / 0 / 0 disposable tips large ( 100 1000 ul ) packet of 1000 nos. 472 23 / 005 / 0060 / 00 / 0 / 0 / 0 slide box plastic 50 slide capacity 473 23 / 005 / 0071 / 00 / 0 / 0 / 0 capilarys for absoluter micropietts 0.5 to 2 ul 474 23 / 005 / 0082 / 00 / 0 / 0 / 0 microscope objectives imported oil immersion lence 100x 475 23 / 005 / 0083 / 00 / 0 / 0 / 0 new methylene blue 25 gm 476 23 / 005 / 0084 / 00 / 0 / 0 / 0 conc. nitric acid 500ml 477 23 / 005 / 0088 / 00 / 0 / 0 / 0 auto sample cup 478 23 / 005 / 0120 / 00 / 0 / 0 / 0 tissue cutting knives 479 23 / 005 / 0128 / 00 / 0 / 0 / 0 tissue cassets ( plastic ) 480 23 / 005 / 0129 / 00 / 0 / 0 / 0 conical flasks 250 ml borosilicate 481 23 / 005 / 0178 / 00 / 0 / 0 / 0 reagent bottles 125ml 482 23 / 006 / 0004 / 00 / 0 / 0 / 0 mueller hinton agar 500gm 483 23 / 006 / 0006 / 00 / 0 / 0 / 0 sabourauds dextrose agar 100gm 484 23 / 006 / 0007 / 00 / 0 / 0 / 0 simmons citrate agar 100gm 485 23 / 006 / 0008 / 00 / 0 / 0 / 0 agar agar powder ( purify for cult.media & bacterio.work ) 500 gm 486 23 / 006 / 0010 / 00 / 0 / 0 / 0 aluminium test tube rack ( 8 x 4 holes ) ( 60mm dia ) 487 23 / 006 / 0012 / 00 / 0 / 0 / 0 mycological needles 488 23 / 006 / 0015 / 00 / 0 / 0 / 0 test tube holder 489 23 / 006 / 0016 / 00 / 0 / 0 / 0 litmus paper 490 23 / 006 / 0018 / 00 / 0 / 0 / 0 anaerobic indicator tablet packet of 10 tablets 491 23 / 006 / 0034 / 00 / 0 / 0 / 0 corn meal agar 500 gm 492 23 / 006 / 0036 / 00 / 0 / 0 / 0 niger seed agar 100 gm 493 23 / 006 / 0048 / 00 / 0 / 0 / 0 bile salt agar 100 gm 494 23 / 006 / 0049 / 00 / 0 / 0 / 0 bromophenol blue powder 100gm 495 23 / 006 / 0055 / 00 / 0 / 0 / 0 measuring cylinder 1000ml borosilicate glass 496 23 / 006 / 0056 / 00 / 0 / 0 / 0 pipette 1ml graduated borosilicate glass 497 23 / 006 / 0057 / 00 / 0 / 0 / 0 pipette 2ml graduated borosilicate glass 498 23 / 006 / 0058 / 00 / 0 / 0 / 0 pipette 5ml graduated borosilicate glass 499 23 / 006 / 0059 / 00 / 0 / 0 / 0 plastic tube with screw cap sterilised dispo. 5ml 500 23 / 006 / 0061 / 00 / 0 / 0 / 0 widal test tube rack plastic 501 23 / 006 / 0065 / 00 / 0 / 0 / 0 buffer tablet std. ( ph 4.0 ) packet of 10 tablet 502 23 / 006 / 0066 / 00 / 0 / 0 / 0 buffer tablet std. ( ph 7.0 ) packet of 10 tablet 503 23 / 006 / 0067 / 00 / 0 / 0 / 0 buffer tablet std. ( ph 9.2 ) packet of 10 tablet 504 23 / 006 / 0069 / 00 / 0 / 0 / 0 egg albumin flakes analytical grade 500gm 505 23 / 006 / 0071 / 00 / 0 / 0 / 0 jack bean meal 100gm 506 23 / 006 / 0073 / 00 / 0 / 0 / 0 n butanol 500ml 507 23 / 006 / 0074 / 00 / 0 / 0 / 0 potassium ferrocyanide ar 500 gm 508 23 / 006 / 0076 / 00 / 0 / 0 / 0 sudan iii powder stain 25 gm 509 23 / 006 / 0077 / 00 / 0 / 0 / 0 sulphar powder lr 500gm 510 23 / 006 / 0081 / 00 / 0 / 0 / 0 acid fuschin 500gm 511 23 / 006 / 0082 / 00 / 0 / 0 / 0 alcian blue 8gx 500ml 512 23 / 006 / 0085 / 00 / 0 / 0 / 0 congo red 100gm 513 23 / 006 / 0086 / 00 / 0 / 0 / 0 ferric amonium sulphate ar 500gm 514 23 / 006 / 0087 / 00 / 0 / 0 / 0 gold chloride 1 gm 515 23 / 006 / 0089 / 00 / 0 / 0 / 0 oxalic acid powder ar 500 gm 516 23 / 006 / 0090 / 00 / 0 / 0 / 0 phosphomolybdic acid a.r ( analytical grade ) 500gm 517 23 / 006 / 0091 / 00 / 0 / 0 / 0 phospho tuvgstic acid analytical grade 100 gm 518 23 / 006 / 0095 / 00 / 0 / 0 / 0 potassium nitrate lr 500 gm 519 23 / 006 / 0099 / 00 / 0 / 0 / 0 butter paper 520 23 / 006 / 0101 / 00 / 0 / 0 / 0 measuring cylinder 100ml borosilicate glass 521 23 / 006 / 0102 / 00 / 0 / 0 / 0 micropipette 1 to 40ul 522 23 / 006 / 0103 / 00 / 0 / 0 / 0 micropipette 20 to 200ul 523 23 / 006 / 0104 / 00 / 0 / 0 / 0 micropipette 200ul to 1ml 524 23 / 006 / 0106 / 00 / 0 / 0 / 0 test tube glass 12 mm x 75 mm 525 23 / 006 / 0107 / 00 / 0 / 0 / 0 westernagreen pipette 526 23 / 006 / 0115 / 00 / 0 / 0 / 0 deodorizing pearls 527 23 / 006 / 0116 / 00 / 0 / 0 / 0 shigella antisera shigella boydii polyvalent 528 23 / 006 / 0117 / 00 / 0 / 0 / 0 shigella antisera shigella dysenteriae polyvalent 529 23 / 006 / 0118 / 00 / 0 / 0 / 0 shigella antisera shigella sonnei 530 23 / 006 / 0119 / 00 / 0 / 0 / 0 shigella antisera shigella flexneri polyvalent 531 25 / 001 / 0026 / 00 / 0 / 0 / 0 specimen jar with glass cover 20cm x 10cm x 5cm 532 25 / 001 / 0028 / 00 / 0 / 0 / 0 specimen jar with glass cover 15cm x 10cm x 5cm 533 25 / 001 / 0035 / 00 / 0 / 0 / 0 test tube glass 100 mm x 12 mm borosilicate 534 25 / 001 / 0036 / 00 / 0 / 0 / 0 test tube glass 125 mm x 15 mm 535 25 / 001 / 0037 / 00 / 0 / 0 / 0 test tube glass 150 mm x 18 mm 536 25 / 001 / 0038 / 00 / 0 / 0 / 0 test tube glass 75 mm x 10 mm borosilicate 537 25 / 001 / 0040 / 00 / 0 / 0 / 0 mc cartneys bottle 30 ml 538 25 / 002 / 0003 / 00 / 0 / 0 / 0 diamond marker 539 25 / 002 / 0013 / 00 / 0 / 0 / 0 alluminium wire basket large size 12x9x7 540 25 / 002 / 0014 / 00 / 0 / 0 / 0 aluminium wire basket 9x8x6 541 25 / 002 / 0024 / 00 / 0 / 0 / 0 esrite stand 10 tube with scale ( to hold 5 pipete ) access 542 25 / 002 / 0025 / 00 / 0 / 0 / 0 funnel 4 diameter borosilicate glass 543 25 / 002 / 0033 / 00 / 0 / 0 / 0 metal spatula for chemical media 544 25 / 002 / 0034 / 00 / 0 / 0 / 0 micropipettes 10ul fix. vol. ( with stand table top & calibration certi ) 545 25 / 002 / 0035 / 00 / 0 / 0 / 0 micripipettes 20ul fix.vol. ( with stand table top & calibration certi ) 546 25 / 002 / 0036 / 00 / 0 / 0 / 0 micropipettes 25ul fix.vol. ( with stand table top & calibration certi ) 547 25 / 002 / 0037 / 00 / 0 / 0 / 0 micropipettes 50ul 200ul vari. volume with calibration certi 548 25 / 002 / 0038 / 00 / 0 / 0 / 0 micropipette 50ul fixed volume with calibration certi 549 25 / 002 / 0039 / 00 / 0 / 0 / 0 micropipette 5 ul fixed volume with calibration certi. 550 25 / 002 / 0040 / 00 / 0 / 0 / 0 micropipettes 1000ul fixed volume with calibration certi 551 25 / 002 / 0041 / 00 / 0 / 0 / 0 micropipette 200ul fixed volume with calibration certi. 552 25 / 002 / 0042 / 00 / 0 / 0 / 0 micropipette 500ul fixed volume with calibration certi. 553 25 / 002 / 0044 / 00 / 0 / 0 / 0 micropipette 100ul 1000ul variable volume with calibration certi 554 25 / 002 / 0047 / 00 / 0 / 0 / 0 micropipette 2ul 20ul variable volume with calibration certi 555 25 / 002 / 0048 / 00 / 0 / 0 / 0 micropipette 5ul 50ul variable volume with calibration certi 556 25 / 002 / 0049 / 00 / 0 / 0 / 0 micropipette 0.5ul 10ul variable volume with calibration certi 557 25 / 002 / 0050 / 00 / 0 / 0 / 0 micropipette 10ul 100ul variable volume with calibration certi 558 25 / 002 / 0052 / 00 / 0 / 0 / 0 mould for holding tissue block big&ss with deep cavity 559 25 / 002 / 0053 / 00 / 0 / 0 / 0 mould for hold tissue block small, ss with deep cavity 560 25 / 002 / 0056 / 00 / 0 / 0 / 0 plastic dropping bottle ( 100ml ) 561 25 / 002 / 0070 / 00 / 0 / 0 / 0 slide stand for drying ( aluminium ) it hold 20 slide 562 25 / 002 / 0077 / 00 / 0 / 0 / 0 test tube brush small 563 25 / 002 / 0078 / 00 / 0 / 0 / 0 test tube brush large 564 25 / 002 / 0079 / 00 / 0 / 0 / 0 test tube brush medium 565 25 / 002 / 0092 / 00 / 0 / 0 / 0 slide staining rack aluminium 24 inch of 2 rodes 566 25 / 003 / 0001 / 00 / 0 / 0 / 0 double pointed needle for vacutainer 22g x 1 inch. 567 25 / 003 / 0004 / 00 / 0 / 0 / 0 filter paper no. 1 ( 90 mm ) box of 100 nos. 568 25 / 003 / 0011 / 00 / 0 / 0 / 0 sv 5 vials ( 5ml ) wide 5ml 569 25 / 003 / 0012 / 00 / 0 / 0 / 0 sv 2 vials ( 2ml ) 570 25 / 003 / 0013 / 00 / 0 / 0 / 0 serum storage vial 0.5ml capacity 571 25 / 004 / 0001 / 00 / 0 / 0 / 0 absorbent paper points no.15 40, milimeter marked, colour coded 572 25 / 004 / 0002 / 00 / 0 / 0 / 0 absorbent paper points no. 45 80, milimeter marked, colour coded 573 25 / 004 / 0003 / 00 / 0 / 0 / 0 airotor diamond burs 574 25 / 004 / 0004 / 00 / 0 / 0 / 0 airotor handpiece oil spray cleaning & lubrication oil, bottle 500ml 575 25 / 004 / 0005 / 00 / 0 / 0 / 0 alginate impression mat.dust free, for dental use, pkt of 450gm 576 25 / 004 / 0006 / 00 / 0 / 0 / 0 alveogyl fibres ( use for b of dry soket ) paste for dental use, pkt 12gm 577 25 / 004 / 0007 / 00 / 0 / 0 / 0 articulating paper 578 25 / 004 / 0009 / 00 / 0 / 0 / 0 base plate packet of 12 nos 579 25 / 004 / 0010 / 00 / 0 / 0 / 0 bonding mat. 7th generation for self etch, adhesive, 5ml liquid 580 25 / 004 / 0011 / 00 / 0 / 0 / 0 calcium hydroxide paste ( pulp caping ) 1pkt 13gm base, 11gm catalyst 581 25 / 004 / 0013 / 00 / 0 / 0 / 0 calcium hydroxide with iodoform 1pkt with 2 syringe of 22gm each 582 25 / 004 / 0016 / 00 / 0 / 0 / 0 clove oil bottle of 110ml, for dental use 583 25 / 004 / 0017 / 00 / 0 / 0 / 0 cold cure acrylic for crown & bridge ( pow. / liq. ) 584 25 / 004 / 0018 / 00 / 0 / 0 / 0 cold cure acrylic for partial denture ( pow / liq ) pink, self polymerising 585 25 / 004 / 0022 / 00 / 0 / 0 / 0 denture soft liner, permanent 586 25 / 004 / 0028 / 00 / 0 / 0 / 0 erich arch bar ( stainless steel ) 587 25 / 004 / 0030 / 00 / 0 / 0 / 0 gi sealant varnish, cavity varnish, protective coating, bottle 30ml 588 25 / 004 / 0032 / 00 / 0 / 0 / 0 glass ionomer cement luting & lining cement 589 25 / 004 / 0033 / 00 / 0 / 0 / 0 glass ionomer cement universal, restorative ( type 2 ) 590 25 / 004 / 0037 / 00 / 0 / 0 / 0 gutta percha cones no.45 80 591 25 / 004 / 0040 / 00 / 0 / 0 / 0 heat cure acrylic ( pow / liq ) pink, for dental use only 592 25 / 004 / 0041 / 00 / 0 / 0 / 0 impression compound pkts of 5 nos. 593 25 / 004 / 0047 / 00 / 0 / 0 / 0 low modulus microhybrid flowable composite 594 25 / 004 / 0051 / 00 / 0 / 0 / 0 modelling wax pink colour 1 pkt of 225gm 595 25 / 004 / 0058 / 00 / 0 / 0 / 0 plaster of paris for dental use 1 bag of 5kg 596 25 / 004 / 0060 / 00 / 0 / 0 / 0 polishing kit for composits 597 25 / 004 / 0062 / 00 / 0 / 0 / 0 restorative composite for ant.post.restoration, 1 syringe of 5gm 598 25 / 004 / 0068 / 00 / 0 / 0 / 0 root canal instrument k file no 6 length 21mm ( pkt of 6 no ) 599 25 / 004 / 0069 / 00 / 0 / 0 / 0 root canal instrument k file no 8 length 21mm ( pkt of 6 no ) 600 25 / 004 / 0070 / 00 / 0 / 0 / 0 root canal instrument k file no 10 length 21mm ( pkt of 6 no ) 601 25 / 004 / 0072 / 00 / 0 / 0 / 0 root canal instrument of mani k files:25mm length no.45 80 602 25 / 004 / 0075 / 00 / 0 / 0 / 0 root canal instrument of mani h files no.45 80 603 25 / 004 / 0077 / 00 / 0 / 0 / 0 root canal instrument spreader no.15 40 length 21mm ( pkt of 6 no ) 604 25 / 004 / 0078 / 00 / 0 / 0 / 0 root canal instrument spreader no.45 80 length 25mm ( pkt of 6 no ) 605 25 / 004 / 0085 / 00 / 0 / 0 / 0 rubber base impression ( condentation silicon ) 606 25 / 004 / 0090 / 00 / 0 / 0 / 0 seperating material jar of 3500ml, cold mould seal 607 25 / 004 / 0092 / 00 / 0 / 0 / 0 sodium hypochloride 5% for dental use only 500ml 608 25 / 004 / 0111 / 00 / 0 / 0 / 0 stainless steel wire ( 26 guage ) 609 25 / 004 / 0112 / 00 / 0 / 0 / 0 stainless steel wire ( 28 guage ) 610 25 / 004 / 0113 / 00 / 0 / 0 / 0 dental stone type 3, for dental use only, 1 bag of 3kg 611 25 / 004 / 0114 / 00 / 0 / 0 / 0 teeth set ( complete ) ref size acryrock no13 ( ant ) no34 ( post ) shade a2, b2 612 25 / 004 / 0117 / 00 / 0 / 0 / 0 yellow sticky wax for dental use pkt of 10 nos 613 25 / 004 / 0121 / 00 / 0 / 0 / 0 zinc oxide eugenol impression paste for dental 614 25 / 004 / 0125 / 00 / 0 / 0 / 0 devitalyzing material paste ( dental ) for devitalization, syringe of 3gm 615 25 / 004 / 0129 / 00 / 0 / 0 / 0 suction tips ( disosable ) plastic packet of 100 nos. 616 25 / 004 / 0132 / 00 / 0 / 0 / 0 edta syringe, edta paste for dental use only, each syringe of 3gm 617 25 / 004 / 0134 / 00 / 0 / 0 / 0 mirror tops no.4 ( for dental use ) jenim 618 25 / 004 / 0144 / 00 / 0 / 0 / 0 cynoacryralic paste of feviquick 619 25 / 004 / 0145 / 00 / 0 / 0 / 0 glass slab 620 25 / 004 / 0146 / 00 / 0 / 0 / 0 dappen dish 621 25 / 004 / 0153 / 00 / 0 / 0 / 0 rubber dam for isolation for dental use 622 25 / 004 / 0154 / 00 / 0 / 0 / 0 teeth set ( partial ) denture include 6 ant.lower & 6 ant. upper 623 25 / 004 / 0155 / 00 / 0 / 0 / 0 teeth set ( partial ) denture include, 8 upper & 8 lower 624 25 / 004 / 0157 / 00 / 0 / 0 / 0 photo cheek retractor ( plastic ) 625 25 / 004 / 0158 / 00 / 0 / 0 / 0 mouth prop ( rubber ) 626 25 / 004 / 0159 / 00 / 0 / 0 / 0 face guard ( plastic ) ( set contains 01 frame & 05 shield ) for dental 627 25 / 004 / 0161 / 00 / 0 / 0 / 0 root canal instrument of k files 21mm length no.8 628 25 / 004 / 0162 / 00 / 0 / 0 / 0 root canal instrument of k files 21mm length no.10 629 25 / 004 / 0164 / 00 / 0 / 0 / 0 dental mirror handle for no.4 mirror 630 25 / 004 / 0172 / 00 / 0 / 0 / 0 rubber bowl ( big ) soft rubber 631 25 / 004 / 0173 / 00 / 0 / 0 / 0 gutta purcha cone 2% ( no.20 ) pkt 120 cone, milimeter marked, color coded 632 25 / 004 / 0174 / 00 / 0 / 0 / 0 gutta purcha cone 2% ( no.25 ) pkt 120 cone, milimeter marked, color code 633 25 / 004 / 0175 / 00 / 0 / 0 / 0 gutta purcha cone 2% ( no.30 ) pkt 120 cone, milimeter marked, color coded 634 25 / 004 / 0176 / 00 / 0 / 0 / 0 carbide bur ( hp 702 ) for dental use 635 25 / 004 / 0177 / 00 / 0 / 0 / 0 k file 21mm length no: 15 636 25 / 004 / 0178 / 00 / 0 / 0 / 0 stainless steel wire no 19 to apply clasp in partial denture pt 637 25 / 004 / 0179 / 00 / 0 / 0 / 0 stainless steel wire no 20 to apply clasp in partial denture pt 638 25 / 004 / 0185 / 00 / 0 / 0 / 0 carbide bur ( hp 703 ) for dental use only 639 25 / 004 / 0187 / 00 / 0 / 0 / 0 gutta purcha cones 2% ( no 15 ) mm marked, color coded ( pkt of 120cones ) 640 25 / 004 / 0188 / 00 / 0 / 0 / 0 root canal instument k file no 20, length 21 mm 641 25 / 004 / 0189 / 00 / 0 / 0 / 0 root canal instument k file no 30, length 21 mm 642 25 / 004 / 0192 / 00 / 0 / 0 / 0 root canal instument h file no 10, length 21 mm 643 25 / 004 / 0193 / 00 / 0 / 0 / 0 root canal instument h file no 15, length 21 mm 644 25 / 004 / 0194 / 00 / 0 / 0 / 0 root canal instument h file no 20, length 21 mm 645 25 / 004 / 0195 / 00 / 0 / 0 / 0 root canal instument h file no 25, length 21 mm 646 25 / 004 / 0196 / 00 / 0 / 0 / 0 root canal instument h file no 30, length 21 mm 647 25 / 004 / 0197 / 00 / 0 / 0 / 0 root canal instument h file no 35, length 21 mm 648 25 / 004 / 0198 / 00 / 0 / 0 / 0 root canal instument h file no 40, length 21 mm 649 25 / 004 / 0206 / 00 / 0 / 0 / 0 root canal instument k file no 45 80, length 25 mm 650 25 / 004 / 0207 / 00 / 0 / 0 / 0 gutta purcha cones 2% ( no 35 ) millimeter mark, color coded, pkt 120 cone 651 25 / 004 / 0208 / 00 / 0 / 0 / 0 gutta purcha cones 2% ( no 40 ) millimeter mark, color coded, pkt 120 cones 652 25 / 004 / 0209 / 00 / 0 / 0 / 0 gutta purcha cones 2% ( no 45 80 ) mm marked, color coded ( pkt 120 cones 653 25 / 004 / 0210 / 00 / 0 / 0 / 0 matrix band stainless steel ivory pattern no 8...

Gujarat Cancer And Research Institute - Gujarat

31304249 re tender for rate contract for laboratory glassware plasticware goods part 1 for the year 2022 2023 and 2023 24 20°c pcr mini cooler, 20°c pcr mini cooler with gel filled cover,22mm x 22mm square cover slips,24mm x 50mm rectangular cover slips,24mm x 60mm rectangular cover slips,3 way rack,4 way flipper rack,4 way microtube rack,alluminium container,aspirator bottle,aspirator bottle,auto pipettes (bluedispensing bottom),auto pipettes (grey dispensing bottom),auto pipettes (yellow dispensing bottom),auto pipettes (yellow dispensing bottom),autopipette 5 50µl,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker glass,beaker measuring with handle,beaker measuring with handle,beaker plastic,beaker plastic,beaker plastic,beaker plastic,beaker plastic,beaker plastic,biopsy cassetts (plastic) with s.s. lid,carboy,carboy with stopcock,centrifuge tube,centrifuge tube,centrifuge tube,centrifuge tube,centrifuge tube box,centrifuge tube box ,cotton swab,couplin jar,couplin jar glass,cryo cube box,cryo rack 50 places,cryobox,cryobox – 100,cryovial with cryo coders (different colors),cylinder plastic,cylinder plastic,cylinder plastic,cylinder plastic,cylinder plastic,cylinder plastic,cylindre plastic,cyro gloves,disposable blade high profile (818),disposable blade low profile (819),disposable syringe filters,disposable tips,disposable tips,disposable tips,disposable tips,disposable tips,disposable tips,dropper pipette glass with rubber tit,dropper pipette glass with rubber tit,dropper rubber,embedding ring (pink),embedding ring (white),embedding ring (yellow),filter tips,filter tips,filter tips,filter tips,fine filter paper,fine filter tips 1250ul,fine filter tips 1250ul,flask conical glass,flask conical glass,flask conical glass,flask conical glass,flask conical glass,flask conical glass,float rack,float rack,freezing vial container with cover,frosted micro slide,funnel,funnel,funnel glass,funnel glass,funnel glass,gel comb,gel loading tips,glass marking pencil,glass rod,glucose test strip,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,halogen bulb,micro cuvettes hb,ice bucket,immersion oil dispensing bottle, long neck,indicator tape for steam autoclave,lab absorbent paper roll roll,magnetic retriever,magnetic stirrer,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,measuring cylinder glass,micro centrifuge container,micro centrifuge tube,micro centrifuge tube,micro centrifuge tube,micro centrifuge tube,micro centrifuge tube,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette,micro pipette tip box,micro pipette tip box,micro pipette tip box,micro pipette tip box,micro pipette tip box.,micro pipette tips,micro pipette tips,micro pipette tips with filter,micro pipette tips with filter,micro pipette tips with filter,micro slide,micro tubes work station rack,microscope slide tray,microtube pestle with motor,mini centrifuge,mini cooler with gel filled cover,mini cooler with gel filled cover,optical plates 96 well skirted 28440,optical sealing films for the 96 well optical plates cat.36590,parafilm m,parafilm roll with dispensor / cutter,pasture pipette,pcr mini cooler,pcr rack with cover,pcr tube,pcr tube,pcr tube with caps,pcr tube with caps,petri dish glass,petri dish glass,petri dish plastic,pipette glass,pipette glass,pipette glass,pipette glass,pipette stand for micro pipette,pipette tips,plastic brushes for laboratory good cleaning,plastic disposable tube,plastic dropper,plastic wash bottle,plastic wash bottle,plastic wash bottle,platform rocker for gels,platic forceps,rack for microtube,rack for microtube,rack for microtube,rack for pcr tube,rack for revasible rack,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reagent bottle glass,reversible pcr rack,reversible rack with cover,rocker,rough filter paper,sample container for stool,sample cup,sample tips,sample tranportation box,slide box,specimen container,specimen container,spilfyter lab sockers,storage vial,storage vial tube (ria vial),super deluxe,super deluxe,test tube glass,test tube glass,test tube glass,test tube glass,test tube glass,test tube glass,test tube rack,test tube rack,test tube rack,test tube stand,thermometer glass,tips for micropipette,tips for micropipettes,tissue culture flask,tissue culture flask,tissue culture flask,tissue culture petri dish plastic,tissue culture plate 12 well,tissue culture plate 24 well,tissue culture plate 4 well,tissue culture plate 6 well,tissue culture plate 96 well,sterile connecting device,universal tips,,universal tips,,urine container,vortex mixer,zippette bottle top dispenser,aluminum slide tray,digital thermometer & hygrometer with prob,finntip 5ml,gel casting tray for 130x 130mm,gel casting tray for 250 mm x 130 mm,low attachment 6 well plates, tissue culture,plus charged slides,reagent tips,slide carrier containers ( steel ),staining containers triagle ( steel ),stem cell cassettes ( stainless steel),sterile cell strainer (por size: 70 um),glass petri plates 150 mm x25 mm,glass petri plates 100 mm x15 mm,pcr tubes 0.5 ml (autoclavable ,conical bottom , with graduation polypropylene),micro centrifuge tubes 1.5 ml(autoclavble , air tight),gel comb,auto pipettes,auto pipettes,auto pipettes,2 ml microcentrifuge tubes,biobanking and cell culture cryogenic tubes,neubar’s chamber,disposable plastic tube12x75(4 5ml),fine filter paper,multipipette m4 repeater m4,stainless steel staining jar with lid,microcentrifuge tube,0.5 µl to 10 µl multichennel reference 2 (8 channels) pipette,micropipettes,micropipettes,micropipettes,micropipettes,micropipettes,micropipettes,75cm² flask,25cm² flask,cell counting slides,qubit assay tubes,sterile cell stainer (40µm),pipette with microtube opener adapter,sterile dispoasble tissue culture pipettes (serological pipette),all in one rack (stand) for multiple volume tubes (15ml,50ml, etc),cell culture chamber with cover slide (8 well),sterile cell culture insert(pc/pe) , polycarbonate membrane (pc), polyester membrane (pe),pasture pipette,rubber pipette bulb,rubber pipette bulb,rubber pipette bulb,culture tubes glass,test tube cleaning brushes with white nylon rounded tuft bristles,test tube cleaning brushes with white nylon rounded tuft bristles,test tube cleaning brushes with white nylon rounded tuft bristles,test tube holding forceps,disposible pippette,cotton swab,zippette bottle top dispenser,glass jar,glass jar,glass jar,centrifuge tube,dropping bottle,dropping bottle,ice tray,lts tips for 10 µl volume,lts tips for 250 µl volume,micro pestle,pap pen for ihc,pcr work station rack,slide rack plastic for deparaffinization,0.1 ml 4 tube & 4 cap strips,plastic slide assembly 25 places,biopsy cassetts with plastic lid,pcr blocks,pcr blocks,8 strip tubes...

Health And Family Welfare Department - Gujarat

31167508 providing laboratory items microbiology etc. in p.d.u.hospital, rajkot (part 3) thumb press dispensing dropper, 3 ml, graduated, 151 154 mm long, certified rnase, dnase free & non pyrogenic,thumb press dispensing dropper, 2 ml, sterile, graduated, 151 154 mm long, individually packed.,thumb press dispensing dropper, 2 ml, graduated, 151 154 mm long, certified rnase, dnase free & non pyrogenic,thumb press dispensing dropper, 1 ml. sterile, graduated, 151 154 mm long, individually packed.,thumb press dispensing dropper, 1 ml, graduated, 151 154 mm long, certified rnase, dnase free & non pyrogenic,tissue paper roll (2 ply, length 50 meter),transport box cool box with 2 gel packs. dimension 10x7x7 inches.,tube rack, autoclavable, 96 places for 0.2 ml tubes with alphanumerical grid mark with lid,tube rack, pp, 60 places for 0.5 ml tubes with alphanumerical grid mark,tube rack, pp, 60 places for 1.5 ml tubes with alphanumerical grid mark,tube rack, pp, 96 places for 1.5 ml tubes with alphanumerical grid mark,universal container with cap, 50 ml sterile,universal container with spatula, sterile, 100 ml,vaccutainer tube with gel + clot activator 4 ml,vaccutainer tube with gel + clot activator 5 ml,vaccutainer tube with gel + clot activator 4 ml with 22 g needle,vaccutainer tube with gel + clot activator 5 ml with 22 g needle,vaccutainer tube with gel + clot activator 7 ml with 22 g needle,vaccutainer tube with k3 edta, 2 ml,vaccutainer tube with k3 edta, 2 ml with 22 g needle,vaccutainer tube with k3 edta, 4 ml,vaccutainer tube with k3 edta, 4 ml with 22 g needle,vaccutainer tube with k2 edta, 3 ml,vaccutainer tube with k2 edta, 3 ml with 22 g needle,vaccutainer tube with k2 edta, 4 ml,vaccutainer tube with k2 edta, 4 ml with 22 g needle,vaccutainer tube with floride, 2 ml,vaccutainer tube with floride, 2 ml with 22 g needle,wash bottle (capacity 500 ml),waste disposal bags autoclavable (10` x 6` weight holding capacity 0.5 kg.),waste disposal bags autoclavable (12` x 10` weight holding capacity 1.0 kg.),waste disposal bags autoclavable (20` x 14` weight holding capacity 2.5 kg.),waste disposal bags autoclavable (34` x 20` weight holding capacity 9.5 kg.),waste disposal bags autoclavable (40` x 20` weight holding capacity 14 kg.),waste disposal bucket (32 liters with lid & inner perforated bin & biohazard symbol – black ),waste disposal bucket (32 liters with lid & inner perforated bin & biohazard symbol – blue),waste disposal bucket (32 liters with lid & inner perforated bin & biohazard symbol – red ),waste disposal bucket (32 liters with lid & inner perforated bin & biohazard symbol – yellow),biosafety cabinet: servicing & calibration (kendro hera safe hs 9),biosafety cabinet: replacement of pre filter (kendro hera safe hs 9),biosafety cabinet: replacement of hepa filters (kendro hera safe hs 9),biosafety cabinet: servicing & calibration (biosafety cabinat class 2a yorko ysi 190),biosafety cabinet: replacement of pre filter (biosafety cabinat class 2a yorko ysi 190),biosafety cabinet: replacement of hepa filter (biosafety cabinat class 2a yorko ysi 190),biosafety cabinet: servicing & calibration (biosafety cabinat class 2a biolinx, spi 4 bsc, safe flow 4),centrifuge machine (8x15ml),centrifuge (36 place for 12.5 x 81 mm size tube),digital weighing balance,elisa micro plate reader,elisa micro plate washer,incubator,loop sterilizer electric,microcentrifuge (pcr strip rotor ),microcentrifuge (8 x 1.5 ml microtube),micropipette (0.5 10 ul), fully autoclavable (finnipipete/eppendorf).,micropipette (100 ul) fully autoclavable (finnipipete/eppendorf).,micropipette (1000 ul) fully autoclavable (finnipipete/eppendorf).,micropipette (100 1000 ul) fully autoclavable (finnipipete/eppendorf).,micropipette (10 100 ul), fully autoclavable (finnipipete/eppendorf).,micropipette (20 200 ul) fully autoclavable (finnipipete/eppendorf).,micropipette (2 20 ul), fully autoclavable (finnipipete/eppendorf).,micropipette (50 ul) fully autoclavable. (finnipipete/eppendorf).,microplate centrifuge (2 microplate),multi channel micropipette, 8 channel, 40 300 ul volume, fully autoclavable (finnipipete/eppendorf).,multi channel micropipette, 8 channel, 5 50 ul volume, fully autoclavable (finnipipete/eppendorf).,needle burner & syringe destroyer (electrical),semi auto biochemistry analyser,digital dry bath incubator,serological water bath,v.d.r.l. rotator,vertical autoclave with digital display,vortex mixer...

Ministry Of Home Affairs - Gujarat

30749291 bids are invited for 0.1 ml pcr strips tube (250*4) compatible with qiagen rotor gene q , 0.2 ml pcr tube flat lid (dnase/ rnase free) (1x1000 nos/pkt) , 0.2 ml 8 strip tubes & optically clear flat caps for real time pcr compatible with thermofisher quantstudio 3 (dnase/rnase free) (200x8 strip per pkt) , sterile nitrile gloves (1x100 pairs) (medium) , sterile nitrile gloves (1x100 pairs) (large) , sterile nitrile gloves (1x100 pairs) (small) , barrier tips 10 ul (sterile, dnase/rnase free) (1x96 nos/pkt) , barrier tips 200 ul (sterile, dnase/rnase free) (1x96 nos/pkt) , barrier tips 1000 ul (sterile, dnase/rnase free) (1x96 nos/pkt) , barrier tips 50 ul (sterile, dnase/rnase free) (1x96 nos/pkt) , barrier tips 20 ul (sterile, dnase/rnase free) (1x96 nos/pkt) , sterile thumb press dispensing dropper (1x500 nos/pkt) , 1.5 ml pcr tube(conical microcentrifuge tube) (dnase/rnase free)(1x500 nos./pkt) , 2 ml microcentrifuge round bottom withflat lid (dnase/rnase free) , micropipette (20 200 ul) ,micropipette (200 1000 ul) , autoclavable bag (large size), autoclavable bag (small size) , 96 well rack for 1.5/2 mlmct , ethanol, high purity (100% pure, 1 liter) , 1.5/2 ml mcttube cryo storage box (1x5 nos./set) , 0.2 ml 96 welltransparent flat top, semi skirt/skirt pcr plate compatiblewith thermofisher quantstudio 3 (dnase/rnase free) 1*25nos/pkt , adhesive sealing film 96 well pcr platecompatible with thermofisher quantstudio 3 (dnase/rnasefree) 1*100 nos/pkt , dynamagtm 2 magnetic stand for 1.5to 2ml mct for magnetic bead based rna extraction kit ,pcr cold preparation racks for 0.2 mctboq title covid laboratory consumables and reagents total quantity : 4425...

Kamdhenu University - Gujarat

30262790 bids are invited for 96 well optical clear qpcr plate compatible with applied biosystem 7500, pcr compatible, dnase, rnase and pcr inhibotors free , opticalclear adheshive film for 96 well qpcr plate compatible with applied biosystem 7500, pcr compatible, dnase, rnase and pcr inhibotors free , 8 well optical clear strip caps compatible with applied biosystem 7500 , 8 well optical clear qpcr strip 0.2 ml, compatible with applied biosystem 7500, pcr compatible, dnase, rnase and pcr inhibotors free , 100 1000 ul filter tips low retention, sterile, nuclease free, 96 tip/box, 6 box/rack , 20 200 ul filter tips low retention, sterile, nuclease free, 96 tip/box, 10 box/rack , 1 10 ul filter tips low retention, sterile, nuclease free, 96 tip/box, 10 box/rack , 1.5 ml microcentrifuge tube 1.5 ml, sterile, nuclease free, transparent, 500 no./bag , 0.5 ml microcentrifuge tube 0.5 0.6 ml, sterile, nuclease free, transparent,1000 no./bag , 0.2 ml pcr tube 0.2 ml, sterile, dnase, rnase and pcr inhibotors free, transparent,1000 no./bag, flat cap, compatible with eppedorf thermocycler, thin walled total quantity : 1...

Gujarat Cancer And Research Institute - Gujarat

30169343 tender document for rate contract for laboratory glassware plasticware goods for the year 2021 2022 and 2022 23 20°c pcr mini cooler, 20°c pcr mini cooler with gel filled cover, 22mm x 22mm square cover slips, 24mm x 50mm rectangular cover slips, 24mm x 60mm rectangular cover slips, 3 way rack, 4 way flipper rack, 4 way microtube rack, alluminium container, aspirator bottle, aspirator bottle, auto pipettes ( bluedispensing bottom ) , auto pipettes ( grey dispensing bottom ) , auto pipettes ( yellow dispensing bottom ) , auto pipettes ( yellow dispensing bottom ) , autopipette 5 50µl, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker glass, beaker measuring with handle, beaker measuring with handle, beaker plastic, beaker plastic, beaker plastic, beaker plastic, beaker plastic, beaker plastic, biopsy cassetts ( plastic ) with s.s. lid, carboy, carboy with stopcock, centrifuge tube, centrifuge tube, centrifuge tube, centrifuge tube, centrifuge tube box, centrifuge tube box , cotton swab, couplin jar, couplin jar glass, cryo cube box, cryo rack 50 places, cryobox, cryobox – 100, cryovial with cryo coders ( different colors ) , cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylinder plastic, cylindre plastic, cyro gloves, disposable blade high profile ( 818 ) , disposable blade low profile ( 819 ) , disposable syringe filters, disposable tips, disposable tips, disposable tips, disposable tips, disposable tips, disposable tips, dropper pipette glass with rubber tit, dropper pipette glass with rubber tit, dropper rubber, embedding ring ( pink ) , embedding ring ( white ) , embedding ring ( yellow ) , filter tips, filter tips, filter tips, filter tips, fine filter paper, fine filter tips 1250ul, fine filter tips 1250ul, flask conical glass, flask conical glass, flask conical glass, flask conical glass, flask conical glass, flask conical glass, float rack, float rack, freezing vial container with cover, frosted micro slide, funnel, funnel, funnel glass, funnel glass, funnel glass, gel comb, gel loading tips, glass marking pencil, glass rod, glucose test strip, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, halogen bulb, micro cuvettes hb, ice bucket, immersion oil dispensing bottle, long neck, indicator tape for steam autoclave, lab absorbent paper roll roll, magnetic retriever, magnetic stirrer, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, measuring cylinder glass, micro centrifuge container, micro centrifuge tube, micro centrifuge tube, micro centrifuge tube, micro centrifuge tube, micro centrifuge tube, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette, micro pipette tip box, micro pipette tip box, micro pipette tip box, micro pipette tip box, micro pipette tip box., micro pipette tips, micro pipette tips, micro pipette tips with filter, micro pipette tips with filter, micro pipette tips with filter, micro slide, micro tubes work station rack, microscope slide tray, microtube pestle with motor, mini centrifuge, mini cooler with gel filled cover, mini cooler with gel filled cover, optical plates 96 well skirted 28440, optical sealing films for the 96 well optical plates cat.36590, parafilm m, parafilm roll with dispensor / cutter, pasture pipette, pcr mini cooler, pcr rack with cover, pcr tube, pcr tube, pcr tube with caps, pcr tube with caps, petri dish glass, petri dish glass, petri dish plastic, pipette glass, pipette glass, pipette glass, pipette glass, pipette stand for micro pipette, pipette tips, plasma sodium heparin spray dry coated, plasma sodium heparin spray dry coated, plastic brushes for laboratory good cleaning, plastic disposable tube, plastic dropper, plastic wash bottle, plastic wash bottle, plastic wash bottle, platform rocker for gels, platic forceps, rack for microtube, rack for microtube, rack for microtube, rack for pcr tube, rack for revasible rack, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reagent bottle glass, reversible pcr rack, reversible rack with cover, rocker, rough filter paper, sample container for stool, sample cup, sample tips, sample tranportation box, slide box, specimen container, specimen container, spilfyter lab sockers, storage vial, storage vial tube ( ria vial ) , super deluxe, super deluxe, test tube glass, test tube glass, test tube glass, test tube glass, test tube glass, test tube glass, test tube rack, test tube rack, test tube rack, test tube stand, thermometer glass, tips for micropipette, tips for micropipettes, tissue culture flask, tissue culture flask, tissue culture flask, tissue culture petri dish plastic, tissue culture plate 12 well, tissue culture plate 24 well, tissue culture plate 4 well, tissue culture plate 6 well, tissue culture plate 96 well, sterile connecting device, universal tips, , universal tips, , urine container, vortex mixer, zippette bottle top dispenser, aluminum slide tray, digital thermometer & hygrometer with prob, finntip 5ml, gel casting tray for 130x 130mm, gel casting tray for 250 mm x 130 mm, low attachment 6 well plates, tissue culture, plus charged slides, reagent tips, slide carrier containers ( steel ) , staining containers triagle ( steel ) , stem cell cassettes ( stainless steel ) , sterile cell strainer ( por size: 70 um ) , glass petri plates 150 mm x25 mm, glass petri plates 100 mm x15 mm, pcr tubes 0.5 ml ( autoclavable , conical bottom , with graduation polypropylene ) , micro centrifuge tubes 1.5 ml ( autoclavble , air tight ) , gel comb, auto pipettes, 2 ml microcentrifuge tubes, biobanking and cell culture cryogenic tubes, neubar’s chamber, disposable plastic tube12x75 ( 4 5ml ) , flash back collection needles, paed . blood collection tube edta, paed.blood collection tube plain clot activator, intravenous neddle ( scalp vein set ) , rapid serum vacuatte, sodium heparin vacuatte, lithium heparin vacuatte, fine filter paper, paed.blood collection vacuate citrate, multipipette m4 repeater m4, stainless steel staining jar with lid, microcentrifuge tube, 0.5 µl to 10 µl multichennel reference 2 ( 8 channels ) pipette, micropipettes, micropipettes, micropipettes, micropipettes, micropipettes, micropipettes, 75cm² flask, 25cm² flask, cell counting slides, qubit assay tubes, sterile cell stainer ( 40µm ) , pipette with microtube opener adapter, sterile dispoasble tissue culture pipettes ( serological pipette ) , all in one rack ( stand ) for multiple volume tubes ( 15ml, 50ml, etc ) , cell culture chamber with cover slide ( 8 well ) , sterile cell culture insert ( pc / pe ) , polycarbonate membrane ( pc ) , polyester membrane ( pe ) , pasture pipette, test tube holding forceps, rubber pipette bulb, rubber pipette bulb, rubber pipette bulb, culture tubes glass, test tube cleaning brushes with white nylon rounded tuft bristles, test tube cleaning brushes with white nylon rounded tuft bristles, test tube cleaning brushes with white nylon rounded tuft bristles, test tube holding forceps, sodium citrate 2.7 ml vacuum blood collection tube, needle with safety lock / holders, edta vaccum tubes, esr 1.6 ml vaccum blood collection tube, sodium fluoride with edta vaccum blood collection tubes, plain clot activator vacuum tubes, gel with clot activator vaccum tubes, disposible pippette, cotton swab, zippette bottle top dispenser, glass jar, glass jar, glass jar, centrifuge tube, dropping bottle, dropping bottle, ice tray, lts tips for 10 µl volume, lts tips for 250 µl volume, micro pestle, pap pen for ihc, pcr work station rack, slide rack plastic for deparaffinization, 0.1 ml 4 tube & 4 cap strips, plastic slide assembly 25 places, biopsy cassetts with plastic lid, urine container 50ml...

Department Of Space - Gujarat

29836513 bids are invited for centrifugetube conical 15ml tarsons make centrifugetube conical 15ml ste, catalog number 546021 , centrifugetube conical bottom 50 tarsons makecentrifugetube conical bottom 50 steril. catalog number 546041 , sample container pp 50 tarsons make sample container pp 50 sterile, product code 510030 , tissue culture petridish tarsons make tissue culture petridish?sterile, product code 960031 , bottle narrow mouth 60ml tarsons make bottle narrow mouth 60ml ldpe, product code 586210 , tissue culture flask with filter cap 75 tarsons make tissue culture flask with filter cap 75, product code 950050 , micropipette tips (2 200 ul) tarsons make micropipette tips (2 200 ul) , micropipette tips (200 1000 ul) tarsons make micropipette tips (200 1000 ul) , micropipette tips (0.2 10ul) tarsons make micropipette tips (0.2 10ul) , maxipense low retention tip (200ul) tarsons make maxipense low retention tip (200ul) , maxipense low retention tip (1000ul) tarsons make maxipense low retention tip (1000ul) , microcentrifuge tube0.5ml tarsons make microcentrifuge tube0.5ml , microcentrifuge tube1.5ml tarsons make microcentrifuge tube ? 1.5ml , low retention microcentrifuge tube0.5ml tarsons make low retention microcentrifuge tube ?0.5ml , low retention microcentrifuge tube1.5ml tarsons make low retention microcentrifuge tube ?1.5ml , reversible rack with cover tarsons make reversible rack with cover total quantity : 1...

Surat Municipal Corporation - Gujarat

29535606 tender for supplying & installing equipments / instruments for rt pcr lab of microbiology of smimer hospital under covid 19"=1 high throughput real time pcr system for in vitro diagnostic use ( ce ivd ) 2 walk away, fully automated nucleic acid extraction system 3a microcentrifuge ( minicentrifuge / minifuge ) for strips 3b microcentrifuge ( minicentrifuge / minifuge ) for tubes 4 non refrigerated tabletop centrifuge 5 plate centrifuge ( refrigerated ) 6 vortex mixer 7a single channel adjustable volume micropipetters: 02 20 ul qty3, 05 50 ul qty 3, 20 200 ul qty 5 & 100 1000 ul qty 7b 8 multi channel multi dispensing pipette 5 5000 μl 7c 8 multi channel adjustable volume pipette 5 50 μl 7d single channel multi dispensing pipette 5 50 μl μl 8 laboratory refrigerator ( vertical ) 9 laboratory deep freezer ( 20°c ) , vertical 10 laboratory deep freezer ( 80°c ) / ultra low freezers, vertical 11 central ups ( 10 kva ) with minimum two ( 02 ) hours battery back up 12a computer with printer, computer table 12b computer with printer, computer table...

Health And Family Welfare Department - Gujarat

28968744 rate contract for procurement of drugs and consumables at gmers hospital, gotri, vadodara. 997. braf 998. ck1/10/5/14(34betae12 clone) 999. antibody cocktails with respective secondary antibody kit and reagents to complete ihc staining procedure 1000. pankeratin (ae 1 / ae3 antibody clone) 1001. poly l lysine 1002. poly l lysine 1003. super enhancer 1004. universal detection kit with blocking serum 1005. leu 7 1006. muc 1007. microphthalmia transcription factor 1008. thrombomodulin 1009. myelin 1010. racemose 1011. serotonin 1012. marker delimiting pen for ihc slides 1013. immunoglobulin heavy chains(cig) 1014. amyloid a 1015. androgens 1016. antimitochondrial antibody 1017. b72.3 1018. beta amyloid 1019. bg 8 1020. cathepsin b 1021. cd24 1022. cd25 1023. cd33 1024. cd36 1025. cd64 1026. cd9 1027. eber 1028. ebv 1029. f13a 1030. f8 1031. glycophorin a 1032. growth hormone 1033. hbme 1 1034. hbsag 1035. hiv,p24 1036. hladr 1037. imp3 1038. moc 31 1039. mum1 protein 1040. pap(prostatic acid phosphatase) 1041. pe 10 1042. plasma cell (clone vs38c) 1043. pp 1044. pth 1045. somatostatin 1046. trap 1047. tryptase 1048. ez dewax solution 1049. epcam 1050. factor viii related antigen 1051. glypican 3 1052. dab chromogen 1053. pax 2 1054. podoplanin 1055. braf 1056. humidity chamber 1057. polymer hrp 1058. printer roll for cell counter compatible with 3 part alta –adx heme 310 cell counter (thermal printer) 1059. kt o3 diluent solution 20 l (compatible with 3 part alta –adx heme 310 cell counter) 1060. kt o3 lyse solution 500 ml (compatible with 3 part alta –adx heme 310 cell counter) 1061. probe cleaner (compatible with 3 part alta –adx heme 310 cell counter) 1062. e z cleaner (compatible with 3 part alta –adx heme 310 cell counter) 1063. tissue freezing medium 1064. rapid spot kits for fructose analysis in semen 1065. filter paper sheet 1066. og 6 (orange g 6 ) with ethyl alcohol 1067. ea 50 (eosin azo 50) with ethyl alcohol 1068. immunoflouroscence consumables 1069. hb standard solution 1070. tissue capsule plastic 1071. ready to use kit for leucocyte alkaline phosphatase stain 1072. esrite kit with cup for autosuction, stand and graduated tubes (0 200) with reader 1073. ala beach for hard cleaning of cell countersystem 1074. printer roll for cell counter for 3 part (abacus) (thermal printer) 1075. printer roll for cell counter for 5 part (abacus junior) (thermal printer) 1076. heamatology quality control(trilevel 16 as per abacus standard , parameter 6x3 ml per unit) 1077. sta ck prest 1078. sta neoplastin 1079. sta calcium chloride 1080. sta d sorbe u 1081. sta fibroprest 1082. sta owren color buffer 1083. sta unicalibrator 1084. sta factor deficiency ix 1085. sta factor deficiency viii 1086. sta cleaner solution 1087. sta coolant 1088. stago cuvettee roll 1089. 1.5ml capacity sample vials with piercible cap 1090. ependroff cup for stago coagulometer 1091. sta unicalibrator for fibrinogen and factor viii 1092. cellulose acetate strip for hb electrophoresis 1093. epsilometer e strip amikacin 1094. epsilometer e strip amp c 1095. epsilometer e strip amoxyclav(2:1) 1096. epsilometer e strip ampicillin + sulbactam 1097. epsilometer e strip aztreonam 1098. epsilometer e strip azitromycin 1099. epsilometer e strip ceftazidime 1100. epsilometer e strip colistin 1101. epsilometer e strip esbl ceftazidime/ceftazidime clavulanic acid 1102. epsilometer e strip esbl cefoperzone/sulbacatm 1103. epsilometer e strip ertapenem 1104. epsilometer e strip erytrhromycin 1105. epsilometer e strip gatifloxacin 1106. epsilometer e strip gentamicin 1107. epsilometer e strip imipenem 1108. epsilometer e strip levofloxacin 1109. epsilometer e strip linezolid 1110. epsilometer e strip mbl 1111. epsilometer e strip meropenem 1112. epsilometer e strip metronidazole 1113. epsilometer e strip mupirocin 1114. epsilometer e strip nalidixic acid 1115. epsilometer e strip netimycin 1116. epsilometer e strip oxacillin 1117. epsilometer e strip oxacillin+ vancomycin 1118. epsilometer e strip penicillin 1119. epsilometer e strip polymixin b 1120. epsilometer e strip prsitinamycin 1121. epsilometer e strip piperacillin + tazobactam 1122. epsilometer e strip tigecycline 1123. epsilometer e strip teicoplanin 1124. epsilometer e strip ticar clavulanic acid 1125. epsilometer e strip vancomycin 1126. epsilometer e strip antifungal amphotericin b 1127. epsilometer e strip antifungal clotrimazole 1128. epsilometer e strip antifungal caspofungin 1129. epsilometer e strip antifungal flucytosine 1130. epsilometer e strip antifungal fluconazole 1131. epsilometer e strip antifungal ketoconazole 1132. epsilometer e strip antifungal itraconazole 1133. epsilometer e strip antifungal posaconazole 1134. epsilometer e strip antifungal voriconazole 1135. epsilometer e strip ceftriaxone 1136. epsilometer e strip cefotaxime 1137. epsilometer e strip cefotaxime 1138. antisera brucella melitensis 1139. antisera bordetella pertussis agglutinating sera 1140. antisera bordetella parapertussis agglutinating sera 1141. antisera e.coli serotypes 1142. antisera h. influenzae polyvalent 1143. antisera h. influenzae type b 1144. antisera neisseria meningitidis polyvalent sera 1145. antisera neisseria meningitidis group w 135 agglultinating sera 1146. antisera salmonella polyvalent o 1147. antisera salmonella h polyvalent phase 1 & 2 1148. antisera salmonella hd 1149. antisera salmonella a h 1150. antisera salmonella b h 1151. antisera shigella dysenteriae poly 1 7, a 1152. antisera shigella dysenteriae poly 7 12, a 1153. antisera shigella flexneri poly 1 6 x,y b 1154. antisera shigella boydii poly 1 6, c 1155. antisera shigella boydii poly 12 15, c 1156. antisera shigella sonnie phase 1 & 2, d 1157. antisera vibrio cholerae polyvalent o1 1158. antisera vibrio cholerae polyvalent o1 inaba 1159. antisera vibrio cholerae polyvalent o1 ogawa 1160. antisera vibrio cholerae o139 1161. antibiotic disc amoxycillin 1162. antibiotic disc amoxycillin + sulbactum 1163. antibiotic disc circle (8 disc) pseudomonas 1164. antibiotic disc circle (8 disc) gram positive bacteria 1165. kit anti hbe antibody 1166. kit cmv igm 1167. kit hsv 1 &2 igm 1168. kit hsv 1 igm 1169. kit hsv 2 igm 1170. kit hsv 1&2 igm 1171. kit hsv 1 igm 1172. kit hsv 2 igm 1173. kit hsv 1&2 igm 1174. kit hsv 1 igm 1175. kit hsv 2 igm 1176. kit measles igm 1177. kit rubella igm 1178. kit rubella igm 1179. kit rubella igm 1180. kit streptococus pneumoniae ag testing for meningitis 1181. kit toxoplasma igm 1182. kit toxoplasma igm 1183. kit toxoplasma igm /igg 1184. immunocomb for detection igm & igg in rubella virus 1185. latex agglutination test kit for detection of antigen of cryptococcus,pneumococcus,meningococcus & h.influenzae 1186. media ready made l j medium slant with ofloxacin 2 micrograms per ml 1187. mr vp medium(dehydrated) veg 1188. potato dextrose agar veg 1189. selenite f broth with dulcitol 1190. tryptone soya agar 1191. tryptone soya broth 1192. trypticase soya agar 1193. trypticase soya broth 1194. tryptic soy broth with bromo cresol purple 1195. atcc strain acinetobacter baumannii 19606 1196. atcc strain acinetobacter baumannii baa 747 1197. atcc strain acinetobacter lwoffii 15309 1198. atcc strain aspergillus niger 16404 1199. atcc strain aspergillus niger 16888 1200. atcc strain bacillus atrophaeus 9372 1201. atcc strain bacillus cereus 10876 1202. atcc strain bacillus subtilis sp subtilis 11774 1203. atcc strain candida albicans 90028 1204. atcc strain candida albicans 90028 1205. atcc strain candida albicans 10231 1206. atcc strain candida albicans 10231 1207. atcc strain candida parapsilosis 22019 1208. atcc strain candida tropicalis 750 1209. atcc strain candida krusei 6258 1210. atcc strain candida krusei 14243 1211. atcc strain candida glabrata 15126 1212. atcc strain candida gullermondii 6260 1213. atcc strain candida kefyr 204093 1214. atcc strain citrobacter fruendii 43864 1215. atcc strain citrobacter koseri 27156 1216. atcc strain clostridium difficile 9689 1217. atcc strain clostridium perfringens 13124 1218. atcc strain corynebacteriae diphtheriae 13812 1219. atcc strain cryptococcus neoformans 14116 1220. atcc strain cryptococcus neoformans 204092 1221. atcc strain enterobacter aerogenes 13048 1222. atcc strain enterococcus fecalis 29212 1223. atcc strain enterococcus fecalis 51299 1224. atcc strain enterococcus feacium 27270 1225. atcc strain e.coli 25922 1226. atcc strain e.coli 35218 1227. atcc strain geobacillus stearothermophilus 7953 1228. atcc strain hemophillus influenzae 49247 1229. atcc strain hemophillus influenzae 49766 1230. atcc strain klebsiella oxytoca 43086 1231. atcc strain klebsiella pneumoniae 700603 1232. atcc strain klebsiella pneumoniae baa 1705 1233. atcc strain klebsiella pneumoniae baa 1706 1234. atcc strain morganella morganii 25829 1235. atcc strain mycobacteruim tuberculosis 25177 1236. atcc strain mycoplasma hominis 15488 1237. atcc strain n. gonorrhoea 49226 1238. standard strain n. gonorrhoea who e 1239. standard strain n. gonorrhoea who c 1240. standard strain n. gonorrhoea nctc 10026 1241. standard strain n. gonorrhoea nctc 8554 1242. atcc strain n. meningitidis 13077 1243. atcc strain n. meningitidis 13090 1244. atcc strain proteus mirabilis 25933 1245. atcc strain proteus vulgaris 49132 1246. horse blood 1247. aliquottes / microcentrifuge tubes 1248. aliquottes / microcentrifuge tubes 1249. aliquottes / microcentrifuge tubes 1250. bottles for blood culture glass , with aluminium cap 1251. bottles for blood culture glass , with aluminium cap 1252. bottles for blood culture glass , with aluminium cap bakelite cap 1253. bottles for blood culture glass , with aluminium cap bakelite cap 1254. discarding jar with lid 1255. discarding jar with lid 1256. discarding jar with lid 1257. discarding jar with lid 1258. dropping bottle 1259. glass bulb for blood brown with rubber stopper 1260. glass container with lid, round mouth 1261. glass container with lid, round mouth 1262. hb set( sahlis acid hematin apparatus) 1263. koplin jar 1264. plastic wash bottles with tube connected 1265. polystyrene sample cups (1.5 ml) 1266. polystyrene sample cups (3 ml) 1267. pre heparinized syringe for abg analysis 1268. rbc pipette 1269. serum storage tubes / secondary tubes with caps 1270. slide trough for staining 1271. urine dipstix 1272. westergren esr tube 1273. wide mouthed glass jars of capacity 500gm with steel caps for viscera 1274. glass bottle with 20cc capacity with steel screw caps for preservation of blood 1275. metal buckets for centrifuge 1276. heat, acid, alkali resistant gloves (size: 7) 1277. slide rinsing trough 1278. tissue capsule 1279. tourniquets for blood donation camps 1280. red cell antigen panel 1281. negative control 1282. blood transfusion set 1283. rare antibody detection disposable kit for gel agglutination system 1284. apheresis disposable kit 1285. temperature recording chart for platelet incubator helmer 1286. temperature recording chart for 80 deep freezer haier 1287. temperature recording chart for 2 8°c blood bag refrigerator haier 1288. temperature recording chart for platelet incubator penpol 1289. temperature recording chart for 2 6° c refrigerator terumopenpol 1290. temperature recording chart for 40° c refrigerator terumo penpol 1291. temperature recording chart for 2 6° c blood bag refrigerator jewette 1292. temperature recording chart for 40 deep freezer haier 1293. temperature recording chart for 40 deep freezer elbenton 1294. temperature chart for remi refrigerator 1295. lancet 1296. safety lancets with retracting needle 1297. waffers for sterile tube connecting device 1298. cuvatte for haemoque 1299. bcl10 1300. beta amyloid 1301. bg 8 1302. cathepsin b 1303. cd24 1304. cd25 1305. cd33 1306. cd36 1307. cd64 1308. cd9 1309. eber 1310. ebv 1311. f13a 1312. f8 1313. glycophorin a 1314. hbme 1 1315. hbsag 1316. hiv,p24 1317. hladr 1318. imp3 1319. moc 31 1320. pap(prostatic acid phosphatase) 1321. pe 10 1322. plasma cell (clone vs38c) 1323. pp 1324. pth 1325. somatostatin 1326. trap 1327. ez dewax solution 1328. factor viii related antigen 1329. factor xiii a 1330. pax 2 1331. podoplanin 1332. braf 1333. printer roll for cell counter compatible with 3 part alta –adx heme 310 cell counter (thermal printer) 1334. kt o3 diluent solution 20 l (compatible with 3 part alta –adx heme 310 cell counter) 1335. kt o3 lyse solution 500 ml (compatible with 3 part alta –adx heme 310 cell counter) 1336. probe cleaner (compatible with 3 part alta –adx heme 310 cell counter) 1337. e z cleaner (compatible with 3 part alta –adx heme 310 cell counter) 1338. high density low viscosity flavoured barium sulphate powder 300gm hdpe glass 1339. pure dye calibration and fppm kit 1340. calibration kit for rp pcr abi machine 1341. vancomycin mic strip 1342. measles elisa test kit 1343. 5 ml vial storage rack 1344. 2 ml vial storage rack 1345. t.o.r.c.h. elisa igm test kit 1346. autoclavable plastic bottle for media preparation 1347. t.o.r.c.h. elisa igg test kit 1348. teasing needle 1349. covid 19 real time pcr kit 1350. covid 19 real time pcr kit 1351. 250μl automated filter tips 1352. 1.3 ml u bottom deep plate 1353. 0.2ml pcr 8 strip tube &flat caps 1354. qia symphony dsp virus path mini kit 1355. 200μl automated filter tips 1356. 1500μl automated filter tips 1357. sample preperation catridge 1358. 8 rod cover 1359. elution microtube cl 1360. tubes,conical 2 ml qsym as 1361. parafilm roll (laboratory sealing film) 1362. antibiotic solution 100x liquid 1363. act kit adult ( sulphadoxin 500mg& pyriethamine 25 mg tablet x 3 +artesunate 100mg tablet x 6) 1364. aledronate sodium 70mg & colecalciferol 500iu tablet 1365. amoxycillin & clavulanic acid disp tablet 228.5mg 1366. anti allergic tablet containing:curcuma longa, ocimum sanctum, adhatoda vasica, embelia ribes. 1367. artesunate 100mg 1368. beclomethasone 200mcg + levosalbutamol 400mcg capsule 1369. beclomethasone200mcg+ salbutamol 400mcg capsule 1370. calcium & phosphorus with vit d3 1371. calcium & phosphorus with vit d3 elemantal calcium 125 mg, vit d3 400 iu 30 tablet 1372. calcium + calcitriol + methylcobalamine + folic + pyridox 1373. calcium aspartate anhydrous (1120mg) equiv. to elemental calcium (146mg)tablet 1374. calcium l 5 methyltetrahydrofolate usp equiv. to l methyl folate (1 mg),methylcobalamin ip (1500 mcg),pyridoxal 5 phosphate (0.5 mg),omega 3 fatty acids containing eicosapentaenoic acid (90 mg),docosahexaenoic acid (60mg),excipients q.s. capsule 1375. calcium l 5 methyltetrahydrofolate usp equiv. to l methyl folate (1mg),methylcobalamin ip (1500 mcg),pyridoxal 5 phosphate (0.5 mg) capsule 1376. calcium phosphate + vit d3 200iu tablet 1377. calcium supplementation containing:balsamodendron mukul (purified), withania somnifera, terminalia arjuna, kukkutandatvak bhasma, godanti bhasma, vanda roxburghii, sida cordifolia. 1378. capsule providing omega 3 fatty acid 300 mg proving eicosapentaenoic acid(epa) 180 mg + docosahexaenoic acid ( dha) 120 mg 1x 30 nos. 1379. capsule proving omega 3 fatty acid 500 mg proving eicosapentaenoic acid(epa) 325mg + docosahexaenoic acid ( dha) 175 mg 1 x 30 nos. 1380. cefaclor 3tablet 750 mg 1381. chlorine tablet 0.5 gm 1382. chlorpheniramine 8mg 1383. chlorzoxazone tablet 1384. cissus quadrangularis extract tablet 500mg 1385. clindamycin capsule 600 mg 1386. clindamycin phosphate 100mg + clotrimazole 200 mg tablet 1387. clomiphene citrate 50 mg + co enzyme q 10 50 mg tablet 1388. cyclonamide tablet 250mg 1389. cyclosporine emulsion 0.05% + glycerine, castor oil, polysorbate 80, carbomar1342 1 x 30 nos. 1390. defrerasirox 180mg 1391. defrerasirox 360mg 1392. defrerasirox 90mg 1393. degarelixe acetate 120mg tablet 1394. degarelixe acetate 80mg tablet 1395. desogestrel 0.15mg+ethinyestradiol 0.03mg tablet 1396. dexletoprofen trometamol equivalent to dexketoprofen 75 mg(extended release)tablet 1397. dexrabeprazole sodium 10 mg tablet 1398. dexraprazole sodium 10 mg (as enteric coated pellets) domperidone maleateequivalent to domperidone 30 mg tablet 1399. diloxanide furoate tablet 500mg 1400. dinoprostone tablet 0.5 mg 1401. epa 180mg &dha 120 mg 1x30 cap 1402. eprisone hydrochlorid (50mg),paracetamol i.p. (325mg) tablet 1403. etizolam (0.25 mg),escitalopram oxalate ip equiv. to escitalopram (5mg) tablet 1404. etizolam (0.25 mg),propranolol hydrochloride ip (20 mg) tablet 1405. etizolam (0.5 mg),escitalopram oxalate ip equiv. to escitalopram (5mg) tablet 1406. etizolam (0.5 mg),propranolol hydrochloride ip (20 mg) tablet 1407. evening pri.oil 1000mg+vita.e 25mg+gamma lino. acid 100mg tablet 1408. exernestane 25mg tablet 1409. faropenem sodium hydrate ip equivalent to faropenem (200mg),potassiumclavulanate diluted ip equiv. to clavulanic acid 125mg tablet 1410. faropenem sodium hydrate ip equivaletnt to faropenem 300mg extended releasetablet 1411. ferrous ascorbate equivalent element iron 100 mg + folic acid 1.1 mg +methylcobalamine 1.5 mg + zinc sulphate mono hydrate tablet 1412. ferrous ascorbate equivalent to elemental iron 100 mg + folic acid 1.1 mg + methylcobalamin 1.5 mg + zinc sulfate monohydrate equivalent to elementalzinc 22.5 mg tablet 1413. folic acid & ferrous sulphate tablet (0.5 mg + 335 mg) 1414. gabapentin tablet 450mg 1415. gabapentin tablet 600mg 1416. gatifloxacin tablet 400 mg 1417. griseofulvin tablet 125mg 1418. hydrochloroquine 100mg 1419. ibandronic acid tablet 6mg 1420. isosorbide monitrate tablet 40mg sr 1421. isosorbide mononitratetablet 50mg 1422. ketoprofen 30mg tablet 1423. l arginine 3 gm tablet 1424. l carnitine , l tartrate equivalent to l carnitine (500mg),mecobalamin ip(1500mcg),folic acid ip (1.5mg) tablet 1425. levofloxacin hemihydrate ip equiv.to levofloxacin (250mg),ornidazole ip(500mg) tablet 1426. liver preparation tablet containing (ds): capparis spinosa, cichorium intybus, solanum nigrum, terminalia arjuna, cassia oxidentalis, achillea millefolium,tamarix gallica,eclipta alba, phyllanthus amarus. 1427. lomustine capsule 100 mg 1428. lomustine capsule 20 mg 1429. lomustine capsule 40 mg 1430. l ornithine + l aspartate chewable tablet 3gm 1431. lumafantrine tablet 460mg 1432. lutein 5mg+ zeaxanthin 1mg + omega 3 fatty acids 500mg ( epa 325mg +dha 175mg) 1433. lyndopa tablet 1434. megesterol acetate tablet 160 mg 1435. megesterol acetate tablet 40 mg 1436. mercaptopurine 50mg 1437. methyl phenidate 10 mg tablet 1438. methyldopa tablet 250 mg 1439. methylphenidate tablet 5 mg 1440. metolaxone tablet 1441. morphine 10 mg tablet 1442. morphine 30 mg tablet 1443. morphine sulphate 10mg in normal release tablet 1444. morphine sulphate tablests 10mg in continus release techonology 1445. morphine sulphate tablests 30mg in continus release techonology 1446. morphine sulphate tablests 60mg in continus release techonology 1447. nilotinib 150mg capsule 1448. nilotinib 200mg capsule 1449. non constipating haemetinic capsule 1450. obeticholic acid 5mg tablet 1451. ondansetron tablet 5mg 1452. paclitaxel 100mg tablet 1453. petoxyphyllin (oxypentiphyllin) tablet 400 mg 1454. polyvitamin tablet 1455. polyvitamin tablet (prophylactic)(nfi formula)each tablet contains: 1) vitamin a ip 2500 iu 2) vitamin d ip 200 iu 3)thiamine hydrochloride ip 2 mg 4)riboflavine ip 2 mg 5) pyridoxine hcl ip 0.5 mg 6) calcium pantothanate ip 1mg 7) niacinamide ip 25 mg 1456. polyvitamin tablet (therapeutic)each tablet contains:1) vitamin a ip 10000 iu2) vitamin d ip 1000 iu3) vitamin b1 5 mg4) vitamin b2 ip 5 mg5) vitamin b6 ip 2 mg6) calcium pantothanate ip 5 mg7) niacinamide ip 50 mg8) vitaminc ip 150 mg9) folic acid ip 1m 1457. prednisolone tablet 40 mg 1458. procarbazine tablet 50 mg 1459. propylthiouracil tablet 50mg 1460. providing omega 3 fatty acid 300 mg providing eicosapentaenoic acid (epa)180 mg + docosahexaenoic acid ( dha) 120 mg cap 1461. pyrimethamine & sulphadoxine tablet 1462. quinine sulphate tablet 100mg 1463. rebamipide ip (100mg) tablet 1464. ribavirin tablet 100 tablet 1465. ruxolitinib 15mg tablet 1466. ruxolitinib 5mg tablet 1467. s etodolac 200mg tablet 1468. s metaprolol 25mg tablet 1469. s pentaprazole 20mg tablet 1470. s ( ) pantoprazole sodium equivalent to s ( ) pantoprazole 20 mgtablet 1471. s ( ) pantoprazole sodium equivalent tos ( ) pantoprazole 20 mg (as enteric coated tablet)domperidone (as domperidone maleate ) 30 mg (as sustained release tablet) tablet 1472. s( ) metoprolol succinate 11.875 mgequivalte to s( ) metoprolol tartrate 12.5 mg tablet 1473. s( ) metoprolol succinate 23.75 mgequivalent to s( ) metoprolol tartrate 25 mg tablet 1474. s( ) metoptolol succinate equivalent to s ( ) metoprolol tartrate 25 mg +telmisartan 20 mg tablet 1475. s( ) metoptolol succinate equivalent to s ( ) metoprolol tartrate 25 mg +telmisartan 40 mg tablet 1476. s( ) pantaprazole sodiumeq. to s( ) pantaprazole 20 mg tablet 1477. s( )metoprolol succinate equivalent to s( )metoprolol tartrate 25 mg (as extended release) atorvastatin calcium equivalent to atorvastation 10mg (asimmediate release) ramipril 5 mg tablet 1478. s( )metoprolol succinate equivalent to s( )metoprolol tartrate 25 mg (as extended release) atorvastatin calcium equivalent to atorvastation 10mg (asimmediate release) ramipril ip 2.5 mg tablet 1479. s( )metoprolol succinate 23.75 mg eq. tos( )metoprolol tartrate 25 mg (extended release)s( ) amlodipine besilate eq. to s( )amlodipine 2.5 mg. tablet 1480. s( )metoprolol succinate 23.75 mg eq. tos( )metoprolol tartrate 25 mg (extended release)s( ) amlodipine besilate eq. to s( )amlodipine 5 mg. tablet 1481. s( )metoprolol succinate 47.50 mg,equivalent to s( )metoprolol tartrate 50 mgtablet 1482. s(metoprolol succinate eq. to s ( )metoprolol tartrate (extended release) 50 mg +hydrochlorothiazide 12.50 mg (immediate release) tablet 1483. s amlodipine 2.5 mg, atenolol 50 mgtablet 1484. s amlodipine 2.50 mghydrochloridethiazide 12.50 mg tablet 1485. s amlodipine 5 mghydrochloridethiazide 12.50 mg tablet 1486. s amlodipine 5 mg,losartan potassium 50 mg tablet 1487. s amlodipine basilate e.q. to,s amlodipine 2.50 mg + telmisartan 40 mgtablet 1488. s amlodipine basilate e.q. to,s amlodipine 5 mg + telmisartan 40 mg tablet 1489. secukinumab 150mg 1490. sinvastatin tablet 40mg 1491. sodium cromoglycate capsule 20mg 1492. sorafenib 400 mg tablet 1493. sparfloxacin tablet 200mg 1494. sulfadoxine 500 mg + pyrimethemine 25mg tablet 1495. terbutalin sulphate tablet 2.5mg 1496. tetracycline capsule 250mg 1497. thalidomide capsule 200mg 1498. thiamine tablet 75mg 1499. thiocolchicoside tablet 16mg 1500. thioridazine 10mg tablet 1501. tocotrienols 12.5 mg + resveratrol 5mg + lutein 5mg + astaxanthin 4mg +zeaxanthin 1mg + zinc 12mg + copper 2mg 1502. tranexamic acid 250mg + ethamsylate 250 mg tablet 1503. tranexamic acid 500 mg + citrus bioflavonoids 150 mg + menadione 20 mcg +tribasic calcium phosphate 144 mg tablet 1504. vardenafil hydrochloride trihydrate usp equiv to vardenafil 10mg tablet 1505. vardenafil hydrochloride trihydrate usp equiv to vardenafil 20mg tablet 1506. vigabatrin tablet 50 mg 1507. vit.a & d capsule 1508. vitamin a capsule 2 lac i.u. 1509. vitamin e capsule/ pearl 800 iu 1510. vitamins + minerals + zinc + antioxidant 1511. injection section 1512. 0.01% ionic silver solution with surfactant, trisbuffer, menthol and glycerol100ml 1513. 0.01% ionic silver solution with surfactant, trisbuffer, menthol and glycerol250ml 1514. actinomycin d 0.5mg 1515. activated prothrombin complex: dried powder in injection (500lus) 1516. acyclovir 1gm / 5ml injection 1517. acyclovir 2gm / 5ml injection 1518. ampicillin sodium injection 500mg(im/slow iv use) 1519. anti diphtheria 10ml 10000iu 1520. anti diphtherial serum injection 1521. artemether injection 80 mg 1522. belomycine sulphate injection 15mg 1523. bleomycin 15mg injection 1524. bupivacaine hydrochloride inj(heavy)(forspinalane) 0.5% 1525. caffeine citrate inj (iv use) 20mg/ml x 3ml 1526. cefeperazone 250mg + tazobactum 250mg 1527. cefepime 500mg + tazobactum 500mg 1528. cefepime+tazobactum 1.5gm 1529. cefpodoxime 50mg/5ml &100mg /5ml inj 1530. ceftazidim pentahydrate equivalents to 2 gm cefazidim and avibactam sodiumequivalent to 0.5g avibactam 1531. cefuroxime 500mg injection 1532. celemin hepa 8% (8% w/v amino acids enriched with bcaa) 500ml 1533. celemin nehro 7% (7% w/v amino acids enriched with bcaa & eaa) 250ml 1534. celemix (750ml of 5% w/v amino acids with 5% w/v sorbitol & 250ml of 20%w/v lct fat emulsion) 1000ml 1535. celepid mct lct 20% (20% mct lct fat emulsion) 250ml 1536. cell culture rabbies vaccinei.p.im/id use 0.5ml vial > 2.5 i.u 1537. cetrolix acetate 3.75 mg injection 1538. chlorphenaramine maleate injection 2ml 1539. chlorpromazine hcl injection 25 mg/ml (2 ml ampoules) 1540. clarithromycin injection 250 mg 1541. clonazepam injection 0.5mg 1542. clonidine 150 mcg injection 1543. cloxacilline sodium injection 500mg 1544. coagulation factor ix ( recombinant) r fix ( plasma / albumin free method) ip1000 iu per vial 1545. coagulation factor ix ( recombinant) r fix ( plasma / albumin free method) ip500 iu, per vial 1546. coagulation factor ix (recombinant) r fix (plasma/albumin free method) ip 250iu per vial 1547. dacarbazine 100mg 1548. dacarbazine 200mg 1549. dacarbazine 500mg 1550. dexketoprofen trometamol equivalent to dexketoprofen 25 mg water forinjection q.s 2ml 1551. dextran 40 injection (for i.v.infusion) 1552. dextranomer 50mg stablized sodium hyaluroniate 15mg injection 1553. diphtheria antitoxin injection 10,000 iu (for im / iv use) (10 ml ampoule) 1554. diphtheria antitoxin injection 20,000 iu (for im / iv use)(10 ml ampoule) 1555. docetaxel injection 200mg 1556. drotaverine hydro. 80 mg+aceclofenac ip 100mg injection 1557. drotaverine hydrochloride injection 3ml 1558. elemune (20% l alanyl l glutamine injection) 100ml 1559. epitrate injection (1ml ampoule) (for intracameral use) 1560. etoposide injection. 500mg 1561. fat emulsion injection with phospholipid/triglycerid 20% 250ml 1562. fentanyl citrate injection 50 mcg/ml(for im/iv/transdermal use)2 ml ampoules 1563. fludarabine 50mg 1564. fluphenazine decanoate injection 25 mg 1565. flurosin 250mg injection 1566. flurouracil 250mg injection 1567. flurouracil 500mg injection 1568. gadopetetate dimeglumine injection (469 mg/ml) 10ml each vial / amp 1569. gas gangrene antitoxin inj 1570. glycopyrronium inhalation solution 25mcg 1571. golimumab 50mg injection 1572. hepatitis b human immunoglobulin injection (100 i.u.) for i.m. use only. 1573. hepatitis b human immunoglobulin injection (200 i.u.) for i.m. use only. 1574. hepatitis b human immunoglobulin injection (540 i.u.) for i.m. use only. 1575. hepatitis b human immunoglobulin injection 1ml(50 i.u.) x 10ml for i.v. useonly. 1576. hepatitis b vaccine injection 10 mg/ml (multi dose) (for im use) 10 ml vial 1577. hepatitis b vaccine injection 20 mg/ml (multi dose) (for im use) 10 ml vial 1578. hepetitis b immunoglobuline injection. iv 500iu inj 1579. human albumin injection. 10% 50ml 1580. human albumin injection. 20% 50ml 1581. human anti rabbies immunoglobulin injection.300 i.u./ 2ml vial 1582. human growth hormone 36 iu cartridges+d2 injection 1583. human intravenus immunoglobulin injection. 2.5gm 100ml 1584. human intravenus immunoglobulin injection. 5gm 100ml 1585. human intravenus immunoglobulin injection.2.5gm 50ml 1586. human normal immunoglobulin for iv use2.5 gm. (ivig 2.5 gm) 1587. hydroxy methyl propyl celulose ( viscomet)2ml injection 1588. hydroxy propyl methyl cellulose 2% vial injection 1589. hydroxymethyl cellulose injection 6% injection 1590. hypromellose ophthalmic solution 20mg/ml 3 ml injection 1591. imipenem & cilastatin i.p. injection.250mg & 250mg vial i/v 1592. immuno nutrition as immuno modulation as intravenous containing l alanyl andl glutamine .available in 100ml. 1593. influenza vaccine injection (h1n1) 1594. insulin lispro 200iu/ml i 3ml prefilled syringe 1595. intra peritoneal dialysis fluid injection 1596. intracameral (preservative free) adrenaline(1:1000) 1ml ampoule injection 1597. intracameral (preservative free) lignocaine (1%) 1ml ampoule injection 1598. intracameral (preservative free) moxifloxacin (0.5%) 0.5ml applicaps injection 1599. intracameral (preservative free) pilocarpine (0.5%) 1ml ampoule injection 1600. intra cameral xylocaine injection 1601. intravenous amino acid infant (10%) injection 1602. iohexol injection 300 mg/ml (for iv use)100 ml vial 1603. iohexol injection 50 ml 1604. ketamine hcl injection 100 mg 2 ml ampoules (deep im/slow iv use) 1605. ketamine hcl injection 500 mg 10 ml (deep imslow iv use) 1606. ketamine hcl injection 50mg (deep im/slow iv use) 1607. ketamine hcl injection 50mg/ml (10ml vial) 1608. l aaparginase 10,000 i.u. 1609. l aaparginase 5,000 i.u. 1610. l asparaginase injection 10000 ku (each vial contains: 10000 k.u. of l araginase) 1611. leucovorin calcium 20mg injection 1612. levobupivacine 0.5% 10ml injection 1613. lignocaine (1%) 1ml amp (intracameral) 1614. lignocaine 2 % ( for i.v.use) 50 ml vials 1615. lignocaine hcl in normal saline injection (iv use)(cardiac ) 50 ml vial 1616. lignocaine viscous 10 % injection 1617. lyophilized alteplase powder 20mg 1618. lyophilized alteplase powder 50mg 1619. lyophilized human immunoglobulin 2. 5 gm 100 ml 1620. lyophilized human immunoglobulin 5 gm 100 ml 1621. m. t. fluid tuberculin diluted 10 tu/ml 1622. magnesium sulphate injection (im use) 1623. menadione sodium bisulphite injection 10 mg/ml – 2 ml ampoules 1624. menotrophin 1200 iu injection 1625. menotrophin 600 iu injection 1626. methocarbamol 10 ml inj 1627. methotraxate 2.5mg injection 1628. methotraxate 50mg injection. preservative free 1629. methylcobalamine 1000 mcg + thiamine 100mg injection 1630. mitomycin 10 mg injection 1631. mitoxantrone 20mg injection 1632. moxifloxacin (0.5%)0.5 ml injection (intracmeral) 1633. moxifloxacin injection (iv) 400mg/100ml 1634. moxifloxacin injection (iv) 400mg/250ml 1635. multiple electrolyte g injection 500 ml ffs bottle for iv infusion 1636. nadroparin injection 0.6 ml 1637. non ionic dimeric iso osmolar iodixanol 270mg 100ml u.s. fdaapproved ct contrast 1638. non ionic dimeric iso osmolar iodixanol 270mg 50ml u.s. fda approvedct contrast 1639. non ionic dimeric iso osmolar iodixanol 320mg 100ml u.s. fdaapproved ct contrast 1640. non ionic dimeric iso osmolar iodixanol 320mg 50ml u.s. fda approvedct contrast 1641. non peglated lipsomal doxorubicin injection. 20mg 1642. olanzapine injection (for im use) 1643. omega 3 omega 6 fatty acid with 10% fish oil emulsion 50ml 1644. paclitaxel 30mg injection 1645. palonosetron injection 1646. pancuronium injection 2mg/ml 1647. pegylated liposomal doxorubicin 50mg 1648. pentoxifylline (oxpentifylline)injection 15 ml 20 mg/ml 1649. pilocarpine (0.5%) 1ml amp injection (intracameral) 1650. pitressine 20 iu injection 1651. polygelin iv preparation(plasma expanding iv fluid)(3.5%infusion solution foriv,sterile and pyrogen free) 1652. prostaglandin f2 alpha (carboprost) 125 microgram injection 1653. prostaglandin f2 alpha (carboprost) 250 microgram injection 1654. pure recombinant follicle stimulating hormone 75 iu 1655. pyridostigmine injection 1mg/ml 1656. quinine dihydrochloride injection (for slow iv use) 1657. rabies immunoglobulin human injection 300 iu 2ml a/v 1658. recombinant human platelet derived growth factor bb gel 0.01 %(becaplermin )(7.5 gm) 1659. recombinant rabies human monoclonal antibody (rdna) 100iu injection 1660. risperidone prolonged release 25mg injection 1661. risperidone prolonged release 37.5mg injection 1662. risperidone prolonged release 50mg injection 1663. ritodrine hydrochloride injection 1664. sodium chloride optha. solution ( balance salt) 200ml glass bottle 1665. sodium nitroprusside injection each vial contains:50 mg of sodiumnitroprusside for iv infusion 1666. somatostatin 3mg injection 1667. standard amino acid solution containing all essential , non essential, semi essential and conditional essential amino acid with taurine advantage,with ke principle (potato egg pattern of protein) of high biological value of 136 ,without sorbitol ,xylitol and electrolyte.available in 10% 100ml 1668. standard amino acid solution containing all essential , non essential, semi essential and conditional essential amino acid with taurine advantage,with ke principle (potato egg pattern of protein) of high biological value of 136 ,without sorbitol ,xylitol and electrolyte.available in 10% 500ml. 1669. standard amino acid solution containing all essential , non essential, semi essential and conditional essential amino acid with taurine advantage,with ke principle (potato egg pattern of protein) of high biological value of 136 ,without sorbitol ,xylitol and electrolyte.available in 5% 500ml 1670. sterile cefoperazon sodium (for inj) (im/iv use) 1gm injection 1671. sterile opthalmic irrigating solution injection 1672. sterile water for lrrigation usp 1000ml 1673. streptokinase injection 5,000 iu 1674. succinylated balance gelatin1. 4% succinylated gelatin molecule with a molecular weight of 30,000 daltons sodium 151mmol/ l potassium 4 mmol/l calcium 1 mmol/l magnesium 1 mmol/l acetate 24.0 chloride 103mmol/l ph 7.4 osmolality 284 mosm/kg 3. in a 500ml specially patented plastic “ecoflac plus†...

Surat Municipal Corporation - Gujarat

28691355 tender for supplying & installing equipments / instruments for rt pcrlab of microbiology on a turnkeybasis in smimer hospital undercovid 19 1 high throughput real time pcr system for in vitro diagnostic use ( ceivd ) 2 walk away, fully automated nucleic acid extraction system 3a microcentrifuge ( minicentrifuge / minifuge ) for strips 3b microcentrifuge ( minicentrifuge / minifuge ) for tubes qty 1 4 non refrigerated tabletop centrifuge 5 plate centrifuge ( refrigerated ) 6 vortex mixer 7 laboratory refrigerator ( vertical ) 8 laboratory deep freezer ( 20°c ) , vertical 9 laboratory deep freezer ( 80°c ) / ultra low freezers, vertical 10a single channel adjustable volume micropipetters: 02 20 ul qty3, 05 50 ul qty 3, 20 200 ul qty 5 & 100 1000 ul qty 5 = 1 set ( general considerations ) 10b 8 multi channel multi dispensing pipette 5 5000 μl 10c 8 multi channel adjustable volume pipette 5 50 μl 10d single channel multi dispensing pipette 5 50 μl μl 11 central ups ( 10 kva ) with minimum two ( 02 ) hours battery back up 12a computer with printer, computer table 12b computer with printer, computer table...

Health And Family Welfare Department - Gujarat

28310374 supply of laboratory items 1. abacus diatro dil diff 2. abacus diatro cleaner 3. abacus diatro hypoclean 4. abacus diatro lyse diff 5. abx basolyse ii 6. abx cleaner 7. abx diluent 8. abx eosinofix 9. abx fluocyte 10. abx lysebio 11. abx minoclair 12. erba h 560 diluent 13. erba h 560 lyse 1 14. erba h 560 lyse 2 15. elite h clean 16. spotchem e plate (na, k, cl) 17. rack type pipette tip (se), for spotchem tm el 1520 18. capillari tube for bt,ct 19. microscope hellogen lamp 20. serum sample vials ( plastic vial) 21. cover slips glass blue ribbon 22. cover slips glass blue ribbon 23. neubers chamber 24. 10 % barium chloride solution 25. acetone detection powder in urine 26. acetone and glocose detection strip in urine 27. csf micro protein 28. csf diluting fluid 29. double distilled water 30. dpx mountant (for cytology and histology slide) 31. disposable e.s.r tube plastic 32. e.s.r. stand for disposable e.s.r tube 33. ecl 105cuvette(semi coagulometer) 34. ecl rfid tag(semi coagulometer) 35. field stain a 36. field stain b 37. fouchet’s reagent 38. g6pd test(qualitative) kit 39. giemsa stain 40. sulphosalicylic acid 30% w/v 41. sulfur powder for mercury spilage 42. gram stain kit 43. hematoxylin and eosinâ stain (h & e stain) 44. leishman’s stain 45. liquid acetone 46. n/10 hydrocloric acid 47. platelate diluting fluid 48. rbc diluting fluid 49. reagent strips for esti.of ketone & glu.in urine 50. reticulocyte count stain 51. dulbeccos phosphate buffered saline 52. semen diluting fluid 53. uri strip for atleast 10 parameters urine albumin, ph, specific gravity, ketone, urobilinogen, rbc, glucose 54. wbc dilutind fluid 55. xylene 56. activated partial thromboplastin time kit 57. bl. sugar kit 58. blood urea kinetic method 59. blood urea kits breathlot end point method(span or beacon) 60. ck mb kit 61. ldl kit 62. hdl kit 63. hepatitis a&e rapid kit (immunochromatography) 64. prothrombin time kit 65. rapid pap stain kit 66. rpr kit carbon partical agglutination 67. s. albumin 68. s. alkaline phosphate kit 69. s. amylase kit 70. s. bilirubin kit 71. s. calcium kit 72. s. creatinine kit 73. s. triglyceride kits 74. s. cholesterol kit 75. s.g.o.t. kit 76. s.g.p.t. kit 77. s. lypase 78. s. urea 79. s. uric acid 80. s. protein 81. s. albub116:b141min 82. s. alkaline phosphate 83. s. amylase kit 84. s. total bilirubin kit 85. s. direct bilirubin kit 86. s. calcium kit 87. s. creatinine kit 88. s. urea 89. s. triglyceride 90. s. cholesterol 91. s.g.o.t. kit 92. s.g.p.t. kit 93. s. lypase 94. ada 95. s.total protein 96. s. glucose 97. s. ldh p 98. s. hdl 99. s. ferritin 100. aso 101. ggt 102. s. uric acid 103. s. magnasium 104. microalbumin 105. rf 106. crp 107. abg analyser cartridge 108. abg analyser cartridge 109. abg analyser cartridge 110. sbp solution pack 111. sicklevue kit 112. urine pregnancy kit (upt rapid) 113. aso test 114. crp test 115. ferritin test 116. hba1c test 117. microalbumin test 118. ra factor test 119. d dimer test 120. vit.d test 121. pct test 122. mispa i3 probe cleaner 123. mispa i3 washing solution 124. aso serology test 125. crp kit 126. ra kit 127. hbsag kit 128. hcv kit 129. hiv kit 130. rapid test strip (treponemal) for syphilis with all accessories, modified tpha principle 131. widal test – slide with all accessories 132. widal test – tube with all accessories 133. hbsag kit 134. leptospira kit 135. leptospira kit 136. hiv kit 137. hbsag kit (hepacard) 138. dengue elisa (ns1) 139. chikungunya igm elisa 140. hepatitis a immunochromatography rapid kit 141. hepatitis e immunochromatography rapid kit 142. albert stain a & b kit 143. gram stain kit 144. afb stain kit 145. nutrient agar 146. nutrient broth 147. mac conkey agar 148. muller hinton agar 149. tcbs agar 150. cled agar 151. blood agar base 152. muller hinton agar 153. agar powder for bacterial growth 154. mac conkey broth double strength 155. sabourad’s dextrose agar with antibiotics 156. chocolate agar 157. chrome uti agar 158. sheep blood agar 159. mueller hinton agar 160. nutrient agar 161. swab with transport media 162. thioglycollate medium 163. cary blair media 164. triple sugar iron agar 165. urea agar base(christensen’s) 166. urea solution 40% w/v 167. urea powder 168. zn stain reagent kit carbol fuschin, decolorizer:20% sulphuric acid, methylene blue 169. simmon’s citrate agar 170. liquid paraffin oil 171. ferric chloride 172. glucose broth 173. gram strain kit: crystal violet, grams iodine,decoloriser: acetone+alcohol, saffranine or basic fuchsin(0.1%) 174. ph indicator strips 175. india ink stain kit 176. kovac’s indole reagent 177. lactophenol cotton blue 178. lugol’s iodine 179. mannitol salt agar 180. peptone water 181. corn meal agar 182. hi crome candia differential agar 183. alkaline peptone water 184. stool occult blood card test 185. alcohol 186. absolute ethanol 187. koh crystals (pellets) 188. concentrated hcl 189. salmonella polyvalent o antisera 190. salmonella h polyvalent 1 and 2 191. vibrio cholera polyvalent o1, inaba,ogawa,o139 each 192. vibrio cholera , inaba antisera 193. shigella dysenteria type 1 polyvalent antisera 194. shigella flexneri polyvalent antisera 195. atcc strain: e coli 25922 196. atcc strain: pseudomonas aeruginosa 27853 197. atcc strain: staphylococcus aureus 25923 198. bile esculin azide agar 199. simmon’s citrate medium 200. robertsons’s cooked meat media 201. blood culture bottle adult(large) brain heart infusion broth with 0.05 % sps 202. blood culture bottle paediatric (small) brain heart infusion broth with 0.05 % sps 203. bac t/alert automated blood culture media bottle (biomeriux) 204. bac t/alert automated blood culture media bottle (biomeriux) 205. bac t/alert automated blood culture media bottle (biomeriux) 206. bac t/alert automated blood culture media bottle (biomeriux) 207. biological sterilization indicator b.stearothermophillus atcc 7953 208. cedar wood immersion oil 209. sterile cotton swabs 210. sterile swab stick with screw cap 211. aluminium tray to carry slides 212. parafilm roll 213. aluminium foil 214. beaker 215. cryo box 216. cryo vial 217. dropping bottles 218. blotting paper sheet 219. measuring cylinder 220. conical flask 221. conical flask 222. felix tubes: widal tube test 223. dreyer’s tubes: widal tube test 224. test tubes 225. test tubes 226. glass slides 227. slides (concave) 228. glass bottles for collection of water sampling 229. wash bottles 230. slide staining rack 231. glass bottle with screw cap 125 ml borosilicate 232. glass bottle with screw cap 50 ml borosilicate 233. test tube holding racks for holding 10 ml test tube 234. test tube holding racks for holding 30 ml test tube 235. ampicillin 236. ampicillin+ salbactam 237. amoxycillin+clavulanic acid 238. ampicillin+cloxacillin 239. piperacillin+tazobactam 240. cefaperazone+salbactam 241. imipenem+edta 242. ceftriaxone+tazobactam 243. ciprofloxacin 244. levofloxacin 245. norfloxacin 246. tetracyclines 247. minocyclines 248. cotrimoxazole 249. imipenem 250. meropenem 251. cefoxitin 252. azithromycin 253. clindamycin 254. chloremphenicol 255. nitrofurantoin 256. daptomycin 257. linezolid 258. vancomycin 259. bacitracin 260. optochin 261. novobiocin 262. cefazolin 263. cefaclor 264. cefixime 265. cefotaxime 266. ceftriaxone+tazobactam 267. cefpodoxime 268. cefipime 269. cefipime+tazobactam 270. colistin 271. polymyxin b (pb) 272. tigecycline (tgc) 273. fosfomycin 274. ticarcillin+clavulanic acid 275. gentamycin 276. amikacin 277. aztreonam 278. imipenem+edta 279. fluconazole (flc) 280. voriconazole 281. itraconazole 282. ketoconazole 283. amphotericin b antifungal disc 284. miconazole 285. antibiotics circles for gram positive cocci, gram negative and resistant urinary isolates 286. petri dish 287. petri dish 288. petri dish 289. slide box 290. thermometer 291. thermometer 292. timer 293. universal container with/without spatula 294. wire loop with handle 295. assorted wire loops 296. brushes for cleaning test tubes 297. tissue paper roll for microscope 298. laboratory filter paper sheets 299. self adhesive labels 300. plastic funnel 301. discard plastic jar 302. membrane filters 303. durham tubes 304. antibiotic zone scale 305. micropipette 10 ul fixed 306. micropipette 20 ul fixed 307. micropipette 50 ul fixed 308. micropipette 200 fix ul 309. micropipette 500 fix ul 310. micropipette 1000 fix ul 311. micropipette 5 50 ul variable volume 312. micropiptte 10 100 ul variable volume 313. micropipette 100 1000 ul variable volume 314. barrier tips 10 ul 315. barrier tips 20 200 ul 316. barrier tips 1000 ul 317. optical pcr tube 318. microcentrifuge tube 1.5 ml 319. microcentrifuge tube 2.0 ml 320. spin column 321. viral transport medium 322. nitrile gloves 323. rnaase zap solution 324. rack for 2ml appendorf tubes 325. rack for vtm (15 ml tubes) 326. absolute ethanol 327. cryo box for 2 ml stock vial 328. cryo box for 5 ml stock vial 329. pipette stand 330. platic beaker 331. isopropyl alchohol (70 80%) 332. methanol solution 333. measuring cylinder 334. measuring cylinder 335. storage vial 2 ml 336. storage vial 5 ml 337. alluminium foil 338. hypochroride solution 339. label for cryo vial (tough tag) 340. tissue paper roll 341. parafilm roll 342. pcr kit (essay kit) 343. rna extractioin kit 344. pcr blocks 345. pcr block film ...

Health And Family Welfare Department - Gujarat

28247021 purchase of medical surgical and laboratory items with auto hematology analyzer with windows 10 monitor 1 iv set 2 puls oxymeter 3 surgical gloves 6.5 inch (1 pair) 4 surgical gloves 7 inch (1 pair) 5 surgical gloves 7.5 inch (1 pair) 6 nasal canula adult 7 nasal canula child 8 nebulizer mask adult 9 nebulizer mask child 10 oxygen mask adult 11 oxygen mask child 12 triple layer mask 13 n95 mask 14 ppe kit/suit/ppe cover all+ safety goggles+ shoes cover 15 death body cover 16 bain circuit 17 nrbm mask adult 18 nrbm mask child 19 disposable.cap. 20 c pap/bipap full face mask medium non vented 21 c pap/bipap full face mask large non vented 22 c pap/bipap full face mask small non vented 23 examination rubber gloves 24 face shield 25 shoes cover 26 infrared thermometer 27 extension line 100cm 28 extension line 200cm 29 reusable non woven plastic apron xl 30 oxygen key 3 in 1 & square nut se 31 oxygen flow meter for central line 32 x ray developer 22.5 later (pack) 33 iv cannula 26no 34 edta 35 gic rest 36 dental file number 15 37 dental file number 20 38 dental file number 25 39 dental file number 30 40 rotarory file 13 41 rotarory file 16 42 rotarory file pack (21mm) 43 minifuge for 1.5 ml & 2ml eppendorf tubed (max. rcf 12,100 × g 14,100 × g, speed should be of 800?–?13,400 rpm (100 rpm?steps) 800?–?14,500 rpm (100rpm?steps) max. capacity: 12 × 1.5/2.0 ml 12 × 1.5/2.0 ml rotors available: 2, acceleration time1 13 s 13 s deceleration time: 1 12 s 12 s display large lcd large lcd, timer 15 s?–?30 min 15 s to 99 min, with continuous run function, noise level < 49 db(a) <52 db(a) volume range: 24 ml ) 44 vortex mixer (speed range: 120v: 300 to 3200 rpm, controls: 3 way power switch speed knob: variable 1 to 10 dial marks) 45 cryobox (capacity 81/box)(should be durable. matte surface on box sides are suitable for printing and or labeling. boxes should withstand temperatures from 80°c to +121°c and will not degrade. should holds 0.5, 1.5, and 2.0ml microtubes as well as most brands of vials. dual alphanumeric grid (inside and outside) for sample identification top of box is clear for visual inspection; bottom is available in four fluorescent colors, natural, or in a pack of assorted colors. fits most standard 2” stainless steel freezer racks) 46 cryovials (2ml) ( should be 100% polypropylene raw material that meets the requirements of usp standard.the productshould be dnase free, rnase free, pyrogen free, and endotoxin free; it is sterilized by gamma irradiation.vials should have screw caped lid.) 47 tube rack for 2 ml eppendorf tube plastic (rack should be for benchtop use or freezer storage. should have 80 place for 2ml. should be autoclavble) 48 nitrite powder free gloves size 6.5 (1 pcs)(should ne non latex, 100% powder free, noncontaminating, ambidextrous, tear resistant cuffs and fully textured surface) 49 nitrite powder free gloves size 7 (1 pcs)(should ne non latex, 100% powder free, noncontaminating, ambidextrous, tear resistant cuffs and fully textured surface) 50 nuclease free water (should be autoclaved, pcr grade water, each lot tested for nuclease contamination.autoclaved, membrane filtered. rnase and dnase free, genomic dna free. ideal for use in any pcr or rt pcr application) 51 minus 80 degree celius temperature deep freezer 185 ltr(capacity 185 litre, powder coating thickness 80 microns after 7 tank process of phosphating insulation, should have 5 nos. of stainless steel shelves, should have hot line anti moisture entry using hot line at the mouth of the cabinet. should compressors hermetically sealed compressors refrigerants high stage: r¬404a & low stage: suva 95, air¬cooled condensers with grooved aluminium fins for effective heat transfer.condenser fan continuous rated from ebm, germany or equivalent standard. controller microprocessor based temperature controller with digital display sensor fast response pt¬100 rtd sensor. alarm audio¬visual alarm for deviation from set conditions. should have safety controller for interlock between high and low stage.) 52 micropipette stand (pipette stand should made of durable acrylic for years of use. the skid resistant feet will prevent the stand from sliding on your bench top. dimension: 11w x 9.25h x 6d) 53 filter microtips with box 10 ul (should provide accurate volume. should be rnase and dnase free and are ideal for handling rna, pcr applications. should be compatible with eppendorf pipettors. should fit tightly to pipettes and be disposable. each lot of tips is subjected to rigorous testing for rnase contamination and is certified to be nuclease free.) 54 filter microtips with box 20 ul (should provide accurate volume. should be rnase and dnase free and are ideal for handling rna, pcr applications. should be compatible with eppendorf pipettors. should fit tightly to pipettes and be disposable. each lot of tips is subjected to rigorous testing for rnase contamination and is certified to be nuclease free.) 55 filter microtips with box 200 ul (should provide accurate volume. should be rnase and dnase free and are ideal for handling rna, pcr applications. should be compatible with eppendorf pipettors. should fit tightly to pipettes and be disposable. each lot of tips is subjected to rigorous testing for rnase contamination and is certified to be nuclease free.) 56 filter microtips with box 1000 ul (should provide accurate volume. should be rnase and dnase free and are ideal for handling rna, pcr applications. should be compatible with eppendorf pipettors. should fit tightly to pipettes and be disposable. each lot of tips is subjected to rigorous testing for rnase contamination and is certified to be nuclease free.) 57 micro amp optical tubes 0.2 ml with cap for real time pcr 8 tubes per strip (1pkt = 1000pcs) (should be sterile and certified dnase and rnase free. should be made of thin wall polypropylene and designed for precise fit in heat blocks to optimize heat transfer. with flat cap for easy piercing and marking. it should be autoclavableat 121°c and will withstand centrifugation to 10,000 x g.) 58 nitrile gloves size 6 (1 pcs) (should ne non latex, 100% powder free, noncontaminating, ambidextrous, tear resistant cuffs and fully textured surface) 59 nitrile gloves size 6.5 (1 pcs) (should ne non latex, 100% powder free, noncontaminating, ambidextrous, tear resistant cuffs and fully textured surface) 60 nitrile gloves size 7.5 (1 pcs) (should ne non latex, 100% powder free, noncontaminating, ambidextrous, tear resistant cuffs and fully textured surface) 61 vtm tube rack 15 ml (should support stable racking of 15ml tubes, temperature and chemical resistance to withstand a variety of lab procedures large, flat endplates for labeling and easy sample identification. should made of dense nylon material and will not float in water bath.) 62 rnase zap rnase decontamination solution (rnaseap should purify the agent used by eliminating rnase contamination from glassware, plastic surfaces, reaction vessels, countertops and pipettors. it shouldalso effectively remove the rnase residues from microcentrifuge tubes without inhibiting subsequent enzymatic reactions. supplier company should be certified for removing rnaase.) 63 pcr strip and pcr plate rack (should have 8 × 12 holes. should made of good quality plastic, should have wide mouth.should be autoclavble) 64 8082 serum phosphours estimation kit based on phospho molybdate 65 vtm kit 66 auto hematology analyzer with windows 10 monitor ...

Health And Family Welfare Department - Gujarat

27671687 supply of laboratory items 280. pro clacitonin 281. il 6 282. d dimer 283. vitamin b12 284. vitamin b3 285. troponin i & t ( quanitative ) 286. beta hcg 287. beta 2 microglobulin 288. alpha 1 antitrypsin 289. apo lipoprotein a1 290. apo lipoprotein b 291. ceruloplasmin 292. heptoglobin 293. lipoprotein a 294. transferrin 295. galactin 3 296. estradiol 297. progesterone 298. prolactin 299. amh 300. testosterone 301. c peptide 302. cortisol 303. insulin 304. pth 305. vitamin d3 306. tsh 307. free t4 308. free t4 309. anti tpo 310. lactate 311. fructosamine 312. uibc 313. tibc 314. psa ( total ) 315. psa ( free ) 316. fsh 317. lh 318. leptin 319. adiponectine 320. zinc 321. inhibin 322. ca 27.29 323. ca 15.3 324. ca 19 9 325. cea 326. ca 125 327. afp 328. cystatin c 329. bnp 330. transferrin 331. galactin 3 332. estradiol 333. progesterone 334. prolactin 335. amh 336. testosterone 337. c peptide 338. cortisol 339. insulin 340. pth 341. vitamin d 342. free t3 343. free t4 344. lactate 345. fructosamine 346. uibc 347. tibc 348. psa ( total &free ) 349. fsh 350. lh 351. leptin 352. adiponectine 353. zinc 354. ammonia 355. measuring cartridge 356. wash cartridge 357. sample cup 358. auto wash 359. acid alkaline wash 360. cuvette 361. cuvette 362. reagent bottle 363. reagent bottle 364. reagent bottle 365. reagent bottle 366. cd 8 wash solution 367. electrolyte reagent pack 368. deproteinizer 369. heparinized glass capillaries for bill p bilirubinometer 370. serum iron estimation kit* 371. serum ferritin estimation kit* 372. hank’s balanced salt solution 10 xwith phenol red without sodium bicarbonate 373. d dimer ( quantitative estimation of d dimer based on turbidimetric immunoassay. r1 & r2 liquid reagent , measuring the range of 200 4000 ng / ml, linearity 10000 ng / ml 374. hb sensor unit 375. hb sensor casing 376. photo electric sensor device ( ls ) 377. device for specimen input ( ds ) 378. waste bottle sensor device with cable 379. plasma glucose estimation kit based on god pod enzymatic end – point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 380. plasma glucose estimation kit based on hexokinase enzymatic uv method ( 2 point analysis ) ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 381. serum ferritin estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 382. serum urea estimation kit based on gldh enzymatic uv kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 383. serum urea estimation kit based on gldh enzymatic uv kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 384. serum urea estimation kit based on modified berthelot method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 385. serum total cholesterol estimation kit based on chod pod enzymatic end – point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 386. serum creatinine estimation kit based on jaffe’s method 2 point rate reaction ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 387. serum creatinine estimation kit based on enzymatic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 388. serum total protein estimation kit based on biuret method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 389. serum albumin estimation kit colorimetric b.c.g. method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 390. serum total and direct bilirubin estimation kit based on jendrassik & grof method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 391. serum total and direct bilirubin estimation kit based on jendrassik & grof method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 392. serum total bilirubin estimation kit for fully automated biochemistry analyzer ( single reagent ) ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 393. serum direct bilirubin estimation kit for fully automated biochemistry analyzer ( single reagent ) ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 394. serum alp ( alkaline phosphatase ) estimation kit, amp ( 2 amino 2 methyl 1 propanol ) buffer, based on ifcc optimised kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 395. serum alp ( alkaline phosphatase ) estimation kit, dea ( diethanolamine ) buffer ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 396. serum sgot estimation kit based on ifcc optimised kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 397. serum sgpt estimation kit based on ifcc optimised kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 398. serum ck mb estimation kit based on ifcc kinetic method ( immunoinhibition ) ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 399. serum total ck estimation kit based on ifcc uv kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 400. serum ldh estimation kit based on ifcc kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 401. serum ggt estimation kit based on ifcc kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 402. serum hdl precipitation reagent based on polyethylene glycol ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 403. serum hdl estimation kit direct method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 404. serum ldl estimation kit direct method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 405. serum triglyceride estimation kit based on gpo pap enzymatic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 406. serum total calcium estimation kit based on arsenazo iii method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 407. calcium ocpc estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 408. serum phosphorus estimation kit based on phospho molybdate uv end point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 409. serum chloride estimation kit based on mercuric thiocyanate method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 410. serum magnesium estimation kit based on xylidyl blue colorimetric end point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 411. serum bicarbonate estimation kit based on colorimetric uv end point / fixed time method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 412. serum alpha ( a ) amylase estimation kit based on enzymatic kinetic ( ifcc ) method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 413. serum lipase estimation kit based on enzymatic kinetic ( ifcc ) method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 414. serum uric acid estimation kit based on uricase pod end point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 415. micro protein estimation kit for determination of protein in urine & csf based on pyrogallol red end point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 416. serum fructosamine estimation kit based on nbt kinetic method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 417. serum total iron estimation kit based on ferrozine colorimetric end point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 418. serum copper estimation kit based on colorimetric end point method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 419. hdl ldl cholesterol calibrator ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 420. ck mb calibrator ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 421. ck mb control set ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 422. bilirubin standard ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 423. bilirubin standards kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 424. chemistry standards kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 425. blood gas controls – pack of normal and abnormal level ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 426. blood gas controls –abnormal level ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 427. fructosamine calibrator ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 428. sampling precision test kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 429. reagent precision test kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 430. quality control serum ( normal level ) ( vendor must provide application sheets / msds and protocol for use of material. temperature, instrument and method specific data, values for all tests in user menu. quote the cost per ml of the reconstitute 431. quality control serum ( pathological higher level ) ( vendor must provide application sheets / msds and protocol for use of material. temperature, instrument and method specific data, values for all tests in user menu. quote the cost per ml of the 432. quality control serum ( pathological lower level ) ( vendor must provide application sheets / msds and protocol for use of material. temperature, instrument and method specific data, values for all tests in user menu. quote the cost per ml of the 433. multicalibrator sera for clinical chemistry assays ( normal level ) ( vendor must provide application sheets / msds and protocol for use of material. temperature, instrument and method specific data, values for all tests in user menu. quote the cost p 434. multicalibrator sera for clinical chemistry assays ( higher level ) ( vendor must provide application sheets / msds and protocol for use of material. temperature, instrument and method specific data, values for all tests in user menu. quote the cost pe 435. multi parameter external quality assessment scheme for routine clinical chemistry investigations ( vendor must provide application sheets / msds and protocol for use of material. temperature, instrument and method specific data, values for all tests i 436. ammonia estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 437. c reactive protein calibrator kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 438. c reactive protein control kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 439. cholinesterase estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 440. g6 pdh estimation kit ( quantitative ) ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 441. immunoturbidi metric kit for hba1c ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 442. hba1c calibrator set kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 443. hba1c control set kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 444. hemolysis reagent for immunoturbidi metric hba1c kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 445. homocysteine calibrator set kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 446. homocysteine estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 447. iga. immunoglobulin a estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 448. igg. immunoglobulin g estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 449. igm. immunoglobulin m estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 450. immunoturbidi metric kit for c reactive protein ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 451. immunoturbidi metric kit for microalbumin ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 452. immunoturbidi metric kit for pre albumin ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 453. iron ( total ) estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 454. lactate estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 455. micro albumin ( micro protein ) in csf / serum / urine estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 456. micro albumin calibrator set kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 457. micro albumin controls set kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 458. pancreatic alpha amylase estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 459. serum cystatin c estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 460. hba1c estimation kit for fully automated biochemistry analyzer ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 461. hba1c estimation kit based on affinity chromatography method ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 462. serum ferritin kit ( latex turbidimetry method ) ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 463. total iron standard kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 464. uibc estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 465. zinc estimation kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 466. hdl / ldl cholesterol control kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 467. rapid troponin i card test ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 468. cassette for detection of acute myocardial infarction ( troponin i, ck mb and myoglobin ) ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 469. serum t3 ( triiodothyronine ) estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 470. serum free t3 ( free triiodothyronine ) estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 471. serum t4 ( thyroxin ) estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 472. serum free t4 ( free thyroxin ) estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 473. serum tsh ( thyroid stimulating hormone ) estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 474. preventive maintenance ( pm ) kit for erba chem 5 plus v2 semiauto analyzer ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 475. serum anti tpo antibodies estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 476. serum ca 19.9 estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 477. serum alpha feto protein estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 478. serum beta hcg estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 479. serum psa estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 480. serum cea estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 481. serum fsh estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 482. serum lh estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 483. multi assay human sera based tumour marker controls kit for laboratory q.c. ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 484. serum ca 125 estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 485. serum adiponectin estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 486. serum leptin estimation kit based on elisa ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 487. serum ca 15.3 estimation elisa kit ( attach complete kit literature with valid iso 13485 & ce mark or us.fda certificate of kit manufacturer ) 488. bees wax 489. tle 1 490. pdl 1 491. pax 5 492. dog 1 493. stat6 494. nut 495. muc 1 496. muc5ac 497. muc6 498. muc4 499. tfe3b 500. b72.3 501. bcl10 502. bcl6 oncoprotein 503. beta amyloid 504. bg 8 505. ca19 9 506. cathepsin b 507. cd3 508. cd103 509. cd11c 510. cd123 511. cd13 512. cd138 513. cd14 514. cd19 515. cd1a 516. cd2 517. cd22 518. cd23 519. cd24 520. cd25 521. cd33 522. cd36 523. cd38 524. cd3 epsilon chain 525. cd4 526. cd43 527. cd45 528. cd45ra 529. cd45ro 530. cd61 531. cd64 532. cd7 533. cd71 534. cd9 535. collagen iv 536. cytokerain18 537. d2 40 538. eber 539. ebv 540. egfr 541. epstein barr virus early antigen 542. epstein barr virus ( lmp ) 543. f13a 544. f8 545. fl1 546. gh 547. glucagon 548. glycophorin a 549. growth hormone 550. hbme 1 551. hbsag 552. hemoglobin a 553. hiv, p24 554. hladr 555. iga, specific for alpha chains 556. igg, specific for gamma chains 557. igm, specific for mu chains 558. imp3 559. ini 1 560. insulin 561. j chain 562. kappa light chains 563. lambda light chains 564. mammaglobin 565. mast cell tryptase 566. mitf 567. moc 31 568. muc2 protein 569. mum1 protein 570. myelin basic protein 571. myod1 572. napsina 573. nestin 574. oct 4 575. pap ( prostatic acid phosphatase ) 576. p 16 577. pcna 578. pe 10 579. plasma cell ( clone vs38c ) 580. pp 581. pr 582. pten 583. pth 584. rcc 585. s 100 586. somatostatin 587. tia 1 588. trap 589. tryptase 590. nkx3.1 591. ez dewax solution 592. alpha 1 antitrypsin 593. alpha 1 antichymotrypsin 594. cd 13 595. cd 14 596. cd 16 597. cdw 75 598. ck 5 599. ck8 & 18 600. ck 14 601. ck 15 602. ck 16 603. ck 17 604. ck 18 605. wt 1 ( antibody to carboxy terminal ) 606. epcam 607. factor viii related antigen 608. factor xiii a 609. p120 610. p5045 / amacr 611. pax 5 612. villin 613. napsin a 614. glypican 3 615. dab buffer 616. dab chromogen 617. dab cromogen with buffer 618. cd41 619. alk / p80 620. pax 8 621. pax 2 622. p 40 623. podoplanin 624. braf 625. cd 3 epsilon chain 626. alk 627. alpha fetoprotein 628. bcl 2 629. bcl 6 630. beta catenin 631. ca 125 632. calcitonin 633. calponin 634. calretinin 635. carcinoembryonic antigen 636. cd 117 637. cd 15 638. cd 2 639. cd 20 640. cd 3 641. cd 30 642. cd 31 643. cd 34 644. cd 45 645. cd 5 646. cd 56 647. cd 68 ( kp 1 ) 648. cd 99 649. cd10 650. cd117 651. cd15 652. cd20 653. cd21 654. cd23 655. cd30 656. cd34 657. cd57 658. cd79a 659. cd8 660. cdx2 661. chorionic gonadotropin ( beta hcg ) 662. chromogranin 663. citric acid ( qualigen only ) 664. ck 19 665. ck 20 666. ck 7 667. ck1 / 10 / 5 / 14 ( 34betae12 clone ) 668. ck5 / 6 669. ck8 ( cam5.2 clone ) 670. cyclind1 671. desmin 672. disodium dihydrogen orthophosphate ( anhydrous form ) ( qualigen only ) 673. e cadherins 674. ema 675. er oestrogen receptor 676. pr progesterone receptor 677. fli i 678. gfap 679. antibody cocktails with respective secondary antibody kit and reagents to complete ihc staining procedure 680. heppar 1 681. her 2 neu 682. high molecular wt cytokeratin ( 34beta e12 ) 683. hmb45 684. human placental lactogen 685. inhibin 686. kappa light chain 687. ki 67 688. lambda light chain 689. leucocyte common antigen 690. melan a 691. mesothelin 692. mib 1 693. muscle specific actin 694. myeloperoxidase 695. myo d1 696. myogenin 697. neurofilament 698. neuron specific enolase 699. p53 700. p63 701. pankeratin ( ae 1 / ae3 antibody clone ) 702. plap 703. poly l lysine 704. poly l lysine 705. polyclonal cea 706. secondary antibody kit with blocking serum 707. psa 708. s 100 709. smooth muscle actin 710. sodium chloride ( qualigen only ) 711. sodium dihydrogen phosphate ( anhydrous form ) 712. super enhancer 713. syaptophysin 714. tdt 715. thyroglobulin 716. trisodium citrate ( qualigen only ) 717. ttf 1 718. type iv collagen 719. uchl 1 720. universal detection kit with blocking serum 721. vimentin 722. wt1 723. smooth muscle myosin heavy chain 724. tag 72 725. ber ep4 726. cadherins 727. caldesmon 728. gcdfp 15 729. hpl ( human placental lactogen ) 730. beta hcg 731. laminin 732. leu 7 733. lysozyme 734. muc 735. microphthalmia transcription factor 736. mitochondrial antigen 737. thrombomodulin 738. uroplakin 739. myelin 740. racemose 741. serotonin 742. fascin 743. marker delimiting pen for ihc slides 744. immunoglobulin heavy chains ( cig ) 745. acth 746. alk protein 747. amyloid a 748. amyloid p 749. aec chromogen with buffer 750. androgens 751. antimitochondrial antibody 752. b72.3 753. bcl10 754. bcl6 oncoprotein 755. beta amyloid 756. bg 8 757. ca19 9 758. cathepsin b 759. cd3 760. cd103 761. cd11c 762. cd123 763. cd13 764. cd138 765. cd14 766. cd19 767. cd1a 768. cd2 769. cd22 770. cd23 771. cd24 772. cd25 773. cd33 774. cd36 775. cd38 776. cd3 epsilon chain 777. cd4 778. cd43 779. cd45 780. cd45ra 781. cd45ro 782. cd61 783. cd64 784. cd7 785. cd71 786. cd9 787. collagen iv 788. cytokerain18 789. d2 40 790. eber 791. ebv 792. egfr 793. epstein barr virus early antigen 794. epstein barr virus ( lmp ) 795. f13a 796. f8 797. fl1 798. gh 799. glucagon 800. glycophorin a 801. growth hormone 802. hbme 1 803. hbsag 804. hemoglobin a 805. hiv, p24 806. hladr 807. iga, specific for alpha chains 808. igg, specific for gamma chains 809. igm, specific for mu chains 810. imp3 811. ini 1 812. insulin 813. j chain 814. kappa light chains 815. lambda light chains 816. mammaglobin 817. mast cell tryptase 818. mitf 819. moc 31 820. muc2 protein 821. mum1 protein 822. myelin basic protein 823. myod1 824. napsina 825. nestin 826. oct 4 827. pap ( prostatic acid phosphatase ) 828. p 16 829. pcna 830. pe 10 831. plasma cell ( clone vs38c ) 832. pp 833. pr 834. pten 835. pth 836. rcc 837. s 100 838. somatostatin 839. tia 1 840. trap 841. tryptase 842. nkx3.1 843. ez dewax solution 844. alpha 1 antitrypsin 845. alpha 1 antichymotrypsin 846. cd 13 847. cd 14 848. cd 16 849. cdw 75 850. ck 5 851. ck8 & 18 852. ck 14 853. ck 15 854. ck 16 855. ck 17 856. ck 18 857. wt 1 ( antibody to carboxy terminal ) 858. epcam 859. factor viii related antigen 860. factor xiii a 861. p120 862. p5045 / amacr 863. pax 5 864. villin 865. napsin a 866. glypican 3 867. dab buffer 868. dab chromogen 869. dab cromogen with buffer 870. cd41 871. alk / p80 872. pax 8 873. pax 2 874. p 40 875. podoplanin 876. braf 877. cd 3 epsilon chain 878. blocking serum ( power block ) 879. humidity chamber 880. polymer hrp 881. hematology quality control ( trilevel 16 tparameter 6x3ml per unit ) compatible with 3 part alta –adx heme 310 cell counter 882. printer roll for cell counter compatible with 3 part alta –adx heme 310 cell counter ( thermal printer ) 883. kt o3 diluent solution 20 l ( compatible with 3 part alta –adx heme 310 cell counter ) 884. kt o3 lyse solution 500 ml ( compatible with 3 part alta –adx heme 310 cell counter ) 885. probe cleaner ( compatible with 3 part alta –adx heme 310 cell counter ) 886. e z cleaner ( compatible with 3 part alta –adx heme 310 cell counter ) 887. tissue freezing medium 888. rapid spot kits for fructose analysis in semen 889. bromocresol blue 890. chromic acid 891. filter paper sheet 892. methenamine silver 893. methyl violet 894. potassium chloride 895. potassium ferricyanide 896. potassium metabisulphite 897. sodium citrate 898. disodium tetraborate 899. glycerine 900. trichloro acetic acid 901. magnesium carbonate 902. potassium acetate anhydrous 903. liqor ammonia 904. mercuric oxide ( red ) 905. stain india ink 906. og 6 ( orange g 6 ) with ethyl alcohol 907. ea 50 ( eosin azo 50 ) with ethyl alcohol 908. anniline blue 909. immunoflouroscence consumables 910. abx diluent 911. abx basolyse ii 912. abx cleaner 913. abx lysebio 914. abx eosinofix 915. minoclair 916. hematology quality control for horiba pentra es60 and xlr ( low, normal and high level ) : abx difftrol ( l, n and h ) 917. glycolic acid 35 % usfda approved ( chemical peel with petridish , brush & measuring cup ) 918. hb standard solution 919. tissue capsule plastic 920. reagent kit for g6pd estimation 921. ready to use kit for leucocyte alkaline phosphatase stain 922. rapid pap kit 923. esrite kit with cup for autosuction, stand and graduated tubes ( 0 200 ) with reader 924. d dimer kit for fdp 925. reagent kit for aptt 926. reagent kit for prothombin time 927. pan malaria rapid kit 928. rpr kits 929. ala beach for hard cleaning of cell countersystem 930. hematology quality control ( trilevel 16 parameter 6x3ml per unit ) compatable for 3 part abacus cell counter 931. printer roll for cell counter for 3 part ( abacus ) ( thermal printer ) 932. printer roll for cell counter for 5 part ( abacus junior ) ( thermal printer ) 933. abacus abaclean rinsing reagent 934. abacus abalyze cf whole blood lysing reagent 935. abacus abaton cf whole blood diluent 936. heamatology quality control ( trilevel 16 as per abacus standard , parameter 6x3 ml per unit ) 937. sta ck prest 938. sta neoplastin 939. sta calcium chloride 940. sta d sorbe u 941. sta fibroprest 942. sta owren color buffer 943. sta unicalibrator 944. sta factor deficiency ix 945. sta factor deficiency viii 946. sta cleaner solution 947. sta coolant 948. stago cuvettee roll 949. 1.5ml capacity sample vials with piercible cap 950. ependroff cup for stago coagulometer 951. sta unicalibrator for fibrinogen and factor viii 952. sta control ( system control ) 953. stirrer red 954. stirrer white 955. rapid malaria kit 956. diatro dill diff 957. diatro cleaner 958. diatro lyse diff 959. diatro eo 960. diatro baso 961. var ii betathal 500 kit 962. hemoglobin a2 lyphsp 963. eqas hemoglobin prog 964. hemoglobin capillary collection kit 965. vaccutainer for blood collection ( non vaccum ) plain 3ml 966. vaccutainer for blood collection ( non vaccum ) plain 3.5ml 967. vaccutainer for blood collection ( non vaccum ) plain 4 ml 968. vaccutainer for blood collection ( non vaccum ) plain 5 ml 969. vaccutainer for blood collection ( non vaccum ) plain with clot activactor 5ml 970. vaccutainer for blood collection ( non vaccum ) edta k3 2ml 971. vaccutainer for blood collection ( non vaccum ) edta k3 2.5ml 972. vaccutainer for blood collection ( non vaccum ) edta k3 3.0ml 973. vaccutainer for blood collection ( non vaccum ) edta k3 3.5ml 974. vaccutainer for blood collection ( non vaccum ) floride 2ml 975. vaccumized blood collection tube –plain ( serum ) 4 ml 976. vaccumized blood collection tube plain ( serum ) 4.5 ml 977. vaccumized blood collection tube plain ( serum ) 5 ml 978. vaccutainer edta 2ml ( dipotassium ) 979. vaccutainer edta 3ml ( dipotassium ) ) 980. vaccutainer edta 4.5ml ( dipotassium ) 981. vaccutainer edta for pediatrics 0.5ml ( dipotassium ) 982. vaccumized blood collection tube with serum separator gel 983. vaccutainer flouride 3ml 984. vaccumized blood collection tube –fluoride ( glucose ) 2ml 985. 3.2% sodium citrate vacuttee 2.0ml for coagulation study 986. 3.2% sodiun citrate vacuttee 3.0ml for coagulation study 987. micro vaccuates for blood collection ( edta ) 988. micro vaccuates for blood collection ( plain ) 989. ph indicator capsule for calibration of ph meter 990. ph strip 991. disposable needle for vacutainer 22g ( 100 needle and 2 holders ) 992. urine quality control ( bilevel control ) 993. 3 parameter urine analysis strip ( alb, sugar, ph ) 994. 10 parameter urine analysis multistrip ( combur test m for cobas u 411 ) 995. tissue roll for microscope cleaning 996. cellulose acetate strip for hb electrophoresis 997. lens cleaning tissue paper 998. litmus paper 999. 10 parameter urine analysis calibration multistrip ( for cobas u 411 ) 1000. kit for stool occult blood 1001. epsilometer e strip amikacin 1002. epsilometer e strip amp c 1003. epsilometer e strip amoxyclav ( 2:1 ) 1004. epsilometer e strip ampicillin + sulbactam 1005. epsilometer e strip aztreonam 1006. epsilometer e strip azitromycin 1007. epsilometer e strip ceftazidime 1008. epsilometer e strip colistin 1009. epsilometer e strip esbl ceftazidime / ceftazidime clavulanic acid 1010. epsilometer e strip esbl cefoperzone / sulbacatm 1011. epsilometer e strip ertapenem 1012. epsilometer e strip erytrhromycin 1013. epsilometer e strip gatifloxacin 1014. epsilometer e strip gentamicin 1015. epsilometer e strip imipenem 1016. epsilometer e strip levofloxacin 1017. epsilometer e strip linezolid 1018. epsilometer e strip mbl 1019. epsilometer e strip meropenem 1020. epsilometer e strip metronidazole 1021. epsilometer e strip mupirocin 1022. epsilometer e strip nalidixic acid 1023. epsilometer e strip netimycin 1024. epsilometer e strip oxacillin 1025. epsilometer e strip oxacillin+ vancomycin 1026. epsilometer e strip penicillin 1027. epsilometer e strip polymixin b 1028. epsilometer e strip prsitinamycin 1029. epsilometer e strip piperacillin + tazobactam 1030. epsilometer e strip tigecycline 1031. epsilometer e strip teicoplanin 1032. epsilometer e strip ticar clavulanic acid 1033. epsilometer e strip vancomycin 1034. epsilometer e strip antifungal amphotericin b 1035. epsilometer e strip antifungal clotrimazole 1036. epsilometer e strip antifungal caspofungin 1037. epsilometer e strip antifungal flucytosine 1038. epsilometer e strip antifungal fluconazole 1039. epsilometer e strip antifungal ketoconazole 1040. epsilometer e strip antifungal itraconazole 1041. epsilometer e strip antifungal posaconazole 1042. epsilometer e strip antifungal voriconazole 1043. epsilometer e strip ceftriaxone 1044. epsilometer e strip cefotaxime 1045. epsilometer e strip cefotaxime 1046. antisera brucella melitensis 1047. antisera bordetella pertussis agglutinating sera 1048. antisera bordetella parapertussis agglutinating sera 1049. antisera e.coli serotypes 1050. antisera h. influenzae polyvalent 1051. antisera h. influenzae type b 1052. antisera neisseria meningitidis polyvalent sera 1053. antisera neisseria meningitidis group w 135 agglultinating sera 1054. antisera salmonella polyvalent o 1055. antisera salmonella h polyvalent phase 1 & 2 1056. antisera salmonella hd 1057. antisera salmonella a h 1058. antisera salmonella b h 1059. antisera shigella dysenteriae poly 1 7, a 1060. antisera shigella dysenteriae poly 7 12, a 1061. antisera shigella flexneri poly 1 6 x, y b 1062. antisera shigella boydii poly 1 6, c 1063. antisera shigella boydii poly 12 15, c 1064. antisera shigella sonnie phase 1 & 2, d 1065. antisera vibrio cholerae polyvalent o1 1066. antisera vibrio cholerae polyvalent o1 inaba 1067. antisera vibrio cholerae polyvalent o1 ogawa 1068. antisera vibrio cholerae o139 1069. antibiotic disc amikacin 1070. antibiotic disc amoxycillin 1071. antibiotic disc amoxycillin + clavulinic acid 1072. antibiotic disc amoxycillin + sulbactum 1073. antibiotic disc ampicillin 1074. antibiotic disc ampicillin 1075. antibiotic disc ampicillin 1076. antibiotic disc ampicillin / cloxacillin 1077. antibiotic disc ampicillin + sulbactum 1078. antibiotic disc azithromicin 1079. antibiotic disc azithromicin 1080. antibiotic disc azlocillin 1081. antibiotic disc aztreonam 1082. antibiotic disc aztreonam 1083. antibiotic disc bacitracin for identification of streptococcus pyogenes 1084. antibiotic disc bacitracin 1085. antibiotic disc carbenicillin 1086. antibiotic disc cefaclor 1087. antibiotic disc cefamandole 1088. antibiotic disc cefazolin 1089. antibiotic disc cefdinir 1090. antibiotic disc cefepime 1091. antibiotic disc cefepime 1092. antibiotic disc cefepime + tazobactum 1093. antibiotic disc cefepime + tazobactum 1094. antibiotic disc cefexime 1095. antibiotic disc cefexime+ clavulanic acid 1096. antibiotic disc cefametazole 1097. antibiotic disc cefonicid 1098. antibiotic disc cefoperazone 1099. antibiotic disc cefoperazone+ sulbactam 1100. antibiotic disc cefoperazone+ sulbactam 1101. antibiotic disc cefoperazone+ sulbactam 1102. antibiotic disc cefoperazone+ tazobactam 1103. antibiotic disc cefotetan 1104. antibiotic disc cefepirome 1105. antibiotic disc cefepirome + clavulanic acid 1106. antibiotic disc cefpodoxime 1107. antibiotic disc cefpodoxime + clavunalic acid 1108. antibiotic disc cefprozil 1109. antibiotic disc ceftazidime 1110. antibiotic disc ceftazidime + clavulanic acid 1111. antibiotic disc ceftazidime + tazobactam 1112. antibiotic disc ceftazidime + tazobactam 1113. antibiotic disc ceftizoxime 1114. antibiotic disc ceftriaxone 1115. antibiotic disc ceftriaxone 1116. antibiotic disc ceftriaxone 1117. antibiotic disc ceftriaxone+ sulbactam 1118. antibiotic disc ceftriaxone + tazobactam 1119. antibiotic disc ceftriaxone + tazobactam 1120. antibiotic disc cefuroxime 1121. antibiotic disc cephadroxyl 1122. antibiotic disc cephalexin 1123. antibiotic disc cephaloridine 1124. antibiotic disc cephaloridine 1125. antibiotic disc cephalothin 1126. antibiotic disc cephotaxime 1127. antibiotic disc cephotaxime 1128. antibiotic disc cephoxitin 1129. antibiotic disc cephradine 1130. antibiotic disc chloramphenicol 1131. antibiotic disc chloramphenicol 1132. antibiotic disc chloramphenicol 1133. antibiotic disc chloramphenicol 1134. antibiotic disc chlortetracycline 1135. antibiotic disc cinoxacin 1136. antibiotic disc ciprofloxacin 1137. antibiotic disc ciprofloxacin 1138. antibiotic disc ciprofloxacin 1139. antibiotic disc ciprofloxacin 1140. antibiotic disc clarithromicin 1141. antibiotic disc clindamycin 1142. antibiotic disc clindamycin 1143. antibiotic disc cloxacillin 1144. antibiotic disc cloxacillin 1145. antibiotic disc cloxacillin 1146. antibiotic disc cloxacillin 1147. antibiotic disc colistin 1148. antibiotic disc colistin 1149. antibiotic disc colistin 1150. antibiotic disc co trimazine 1151. antibiotic disc cotrimoxazole ( supha / trimethoprim ) 1152. antibiotic disc doxycycline 1153. antibiotic disc doxycycline 1154. antibiotic disc enoxacin 1155. antibiotic disc enrofloxacin 1156. antibiotic disc enrofloxacine 1157. antibiotic disc ertapenem 1158. antibiotic disc erythromycin 1159. antibiotic disc erythromycin 1160. antibiotic disc erythromycin 1161. antibiotic disc feropenem 1162. antibiotic disc floxidine 1163. antibiotic disc fosfomycin 1164. antibiotic disc fosfomycin 1165. antibiotic disc framycetin 1166. antibiotic disc fusidic acid 1167. antibiotic disc fusidic acid 1168. antibiotic disc furazolidone 1169. antibiotic disc furoxone 1170. antibiotic disc gatifloxacin 1171. antibiotic disc gatifloxacin 1172. antibiotic disc gatifloxacin 1173. antibiotic disc gemifloxacin 1174. antibiotic disc gentamicin 1175. antibiotic disc gentamicin 1176. antibiotic disc gentamicin 1177. antibiotic disc gentamicin 1178. antibiotic disc imipenem 1179. antibiotic disc imipenem / cilastin 1180. antibiotic disc imipenem + edta 1181. antibiotic disc isepamicin 1182. antibiotic disc kanamycin 1183. antibiotic disc kanamycin 1184. antibiotic disc levofloxacin 1185. antibiotic disc lincomycin 1186. antibiotic disc lincomycin 1187. antibiotic disc lincomycin 1188. antibiotic disc linezolid 1189. antibiotic disc lomefloxacin 1190. antibiotic disc lomefloxacin 1191. antibiotic disc lomefloxacin 1192. antibiotic disc mecillanam 1193. antibiotic disc meropenem 1194. antibiotic disc methanamine mandelate 1195. antibiotic disc methicillin 1196. antibiotic disc methicillin 1197. antibiotic disc methicillin 1198. antibiotic disc metronidazole 1199. antibiotic disc metronidazole 1200. antibiotic disc mezlocillin 1201. antibiotic disc minocycline 1202. antibiotic disc moxalactum 1203. antibiotic disc moxifloxacin 1204. antibiotic disc mupirocin 1205. antibiotic disc nafcillin 1206. antibiotic disc nadifloxacin 1207. antibiotic disc nalidixic acid 1208. antibiotic disc neomycin 1209. antibiotic disc netilin ( neomycin sulphate ) 1210. antibiotic disc netilin ( neomycin sulphate ) 1211. antibiotic disc nirtofurantoin 1212. antibiotic disc nirtofurantoin 1213. antibiotic disc nirtofurantoin 1214. antibiotic disc nitrofurazone 1215. antibiotic disc nitroxoline 1216. antibiotic disc norfloxacin 1217. antibiotic disc novobiocin 1218. antibiotic disc novobiocin 1219. antibiotic disc ofloxacin 1220. antibiotic disc ofloxacin 1221. antibiotic disc olaendomycin 1222. antibiotic disc oxacillin 1223. antibiotic disc oxacillin 1224. antibiotic disc oxy tetracycline 1225. antibiotic disc pefloxacin 1226. antibiotic disc penicillin g 1227. antibiotic disc penicillin g 1228. antibiotic disc penicillin g 1229. antibiotic disc pipemidic acid 1230. antibiotic disc pipemidic acid 1231. antibiotic disc piperacillin 1232. antibiotic disc piperacillin + tazobactum 1233. antibiotic disc polymixin b for differentiation of cholera organism 1234. antibiotic disc polymixin b 1235. antibiotic disc polymixin b 1236. antibiotic disc prestinomycin ( quinupristin dalfopristin ) 1237. antibiotic disc prulifloxacin ( ulifloxacin ) 1238. antibiotic disc prulifloxacin ( ulifloxacin ) 1239. antibiotic disc rifampicin 1240. antibiotic disc rifampicin 1241. antibiotic disc rifampicin 1242. antibiotic disc rifampicin 1243. antibiotic disc roxithromycin 1244. antibiotic disc sisomicin 1245. antibiotic disc sparfloxacin 1246. antibiotic disc spectinomycin 1247. antibiotic disc spiramycin 1248. antibiotic disc spiramycin 1249. antibiotic disc streptomycin 1250. antibiotic disc streptomycin 1251. antibiotic disc streptomycin 1252. antibiotic disc sterile disc 1253. antibiotic disc sulphasomidine 1254. antibiotic disc sulphadiazine 1255. antibiotic disc sulphadiazine 1256. antibiotic disc sulphafurazole 1257. antibiotic disc sulphamethizole 1258. antibiotic disc sulphamethoxypyredazine 1259. antibiotic disc sulphaphenazole 1260. antibiotic disc tiecoplanin 1261. antibiotic disc tetracycline 1262. antibiotic disc tetracycline 1263. antibiotic disc ticarcillin 1264. antibiotic disc ticarcillin + clavulanic acid 1265. antibiotic disc tigecycline 1266. antibiotic disc tobramycin 1267. antibiotic disc tobramycin 1268. antibiotic disc trimethoprim 1269. antibiotic disc trimethoprim 1270. antibiotic disc trimethoprim 1271. antibiotic disc trimethoprim 1272. antibiotic disc triple sulphas 1273. antibiotic disc tylosine 1274. antibiotic disc vancomycin 1275. antibiotic disc vancomycin 1276. antibiotic disc virginamycin 1277. antifungal disc amphotericin b 1278. antifungal disc amphotericin b 1279. antifungal disc amphotericin b 1280. antifungal disc caspofungin ( echinocandin ) 1281. antifungal disc clotrimazole 1282. antifungal disc fluconazole 1283. antifungal disc fluconazole 1284. antifungal disc itraconazole 1285. antifungal disc itraconazole 1286. antifungal disc ketoconazole 1287. antifungal disc ketoconazole 1288. antifungal disc ketoconazole 1289. antifungal disc miconazole 1290. antifungal disc miconazole 1291. antifungal disc nystatin 1292. antifungal disc nystatin 1293. antifungal disc voriconazole 1294. antifungal disc voriconazole 1295. differential disc bacitracin 1296. differential disc bile esculin 1297. differential disc indole 1298. differential disc indole 1299. differential disc hippurate 1300. differential disc kovacs reagent strip 1301. differential disc kovacs reagent strip 1302. differential disc nitrate reagent disk 1303. differential disc nitrocefin 1304. differential disc onpg 1305. differential disc optochin ( 5 microgram ) 1306. differential disc oxidase 1307. differantial disc spore strips 1308. differantial disc x factor 1309. differantial disc v factor 1310. differantial disc x + v factor 1311. antibiotic disc circle ( 8 disc ) gram positive bacteria 1312. antibiotic disc circle ( 8 disc ) gram negative bacteria 1313. antibiotic disc circle ( 8 disc ) pseudomonas 1314. antibiotic disc circle ( 8 disc ) gram positive bacteria 1315. antibiotic disc circle ( 8 disc ) gram negative bacteria 1316. antibiotic disc circle ( 8 disc ) pseudomonas 1317. gram positive antibiotic disc octa ring g 15 1318. gram positive antibiotic disc octa ring g 16 1319. pyr reagent 1320. antifungal disc fluconazole 1321. kit anti hav igm 1322. kit anti hav igm 1323. kit anti hbc igm antibody 1324. kit anti hbc igm antibody 1325. kit anti hbe antibody 1326. kit anti hbeab antibody 1327. kit anti hbeab antibody 1328. kit anti hbeab antibody 1329. kit anti hbs antibody 1330. kit anti hbs antibody 1331. kit anti hbs antibody 1332. kit anti hbs antibody 1333. kit anti leptospira igg / igm antibodies 1334. kit anti leptospira igg / igm antibodies 1335. kit anti leptospira igg / igm antibodies 1336. kit anti leptospira igg / igm antibodies 1337. kit anti leptospira igm antibodies 1338. kit anti leptospira igm antibodies 1339. kit anti leptospira igm antibodies 1340. kit anti sle antibody 1341. kit anti sle antibody 1342. kit anti sle antibody 1343. kit anti treponema pallidum antibody 1344. kit anti treponema pallidum antibody 1345. kit anti treponema pallidum antibody 1346. kit anti treponema ( syphilis ) antibodies 1347. kit anti treponema ( syphilis ) antibodies 1348. kit anti treponema ( syphilis ) antibodies 1349. kit aso 1350. kit cmv igm 1351. kit crp kit 1352. kit dengue antibody igm 1353. kit dengue antibody igm & igg 1354. kit anti hbs antibody ( quantitative ) 1355. kit anti hcv antibody 1356. kit anti hcv antibody 1357. kit anti hcv antibody 1358. kit anti hev igm 1359. kit anti hev igm / igg 1360. kit anti hev igm / igg 1361. kit anti hev igm / igg 1362. kit anti hev igm / igg 1363. kit anti hev igm / igg 1364. kit anti hiv 1 & 2 antibody 1365. kit anti hiv 1 & 2 antibody 1366. kit anti hiv 1 & 2 antibody 1367. kit anti hiv 1 & 2 antibody 1368. kit anti hiv 1 & 2 antibody 1369. kit dengue antibody igm & igg 1370. kit dengue antibody igm & igg 1371. kit dengue antibody igm & igg 1372. kit hbsag ( hepatitis b surface antigen ) 1373. kit hsv 1 &2 igm 1374. kit hsv 1 igm 1375. kit hsv 2 igm 1376. kit hsv 1&2 igm 1377. kit hsv 1 igm 1378. kit hsv 2 igm 1379. kit hsv 1&2 igm 1380. kit hsv 1 igm 1381. kit hsv 2 igm 1382. kit hsv 1 igm 1383. kit hsv 2 igm 1384. dengue ns1 antigen detection kit by elisa under nvbdcp ( national vactor borne disease control programme ) 1385. kit typhoid rapid test 1386. kit typhoid rapid test 1387. kit typhoid rapid test 1388. kit typhoid rapid test 1389. kit measles igm 1390. kit ra test with all accessories 1391. kit rpr test for syphilis with all accessories ( white cards as per number of tests ) 1392. kit rpr test for syphilis with all accessories ( white cards as per number of tests ) 1393. kit rubella igm 1394. kit rubella igm 1395. kit rubella igm 1396. kit streptococus pneumoniae ag testing for meningitis 1397. kit toxoplasma igm 1398. kit toxoplasma igg / igm 1399. kit toxoplasma igm 1400. kit toxoplasma igm / igg 1401. kit treponema pallidum ab detection 1402. kit treponema pallidum ab detection 1403. kit treponema pallidum ab detection 1404. kit treponema pallidum heamagglutination test 1405. kit treponema pallidum heamagglutination test 1406. kit widal slide test with all accessories 1407. kit widal tube test with all accessories 1408. immunocomb for detection igm & igg in rubella virus 1409. latex agglutination test kit for detection of antigen of cryptococcus, pneumococcus, meningococcus & h.influenzae 1410. anti chikungunya igm ab detection by capture elisa 1411. media dehydrated powder actinomycetes agar veg 1412. amines transport medium with charcol 1413. d ( + ) glucose ( dextrose ) anhydrous bacteriological grade 1414. halophilic agar veg 1415. hartleys broth veg 1416. hoyle medium base ( dehydrated ) 1417. iodine analytical grade 1418. lactose monohydrate bacteriological grade 1419. lactose monohydrate bacteriological grade 1420. lead acitate agar 1421. malonate broth ( dehydrated ) 1422. meat extract powder veg 1423. media dehydrated powder agar agar powder 1424. media dehydrated powder alkaline peptone water veg 1425. media dehydrated powder bile esculin agar base veg 1426. media dehydrated powder bile salt agar 1427. media dehydrated powder enterococcus faecium selective supplement 1428. media l arginine 1429. media l lysine 1430. media ready made nitrate broth 1431. media ready made candida identification kit with combination of 12 tests 1432. media ready made dca agar plate veg 1433. media ready made enterobacteriaceae identification kit with combination of 25 tests 1434. media ready made indole nitrate broth veg 1435. media ready made l j medium slant 1436. media ready made l j medium slant with ofloxacin 2 micrograms per ml veg 1437. media ready made l j medium slant with ofloxacin 2 micrograms per ml 1438. media ready made mr vp ( glucose phosphate ) broth veg 1439. media ready made of medium with dextrose 1440. media ready made salmonella identification kit with combination of 12 tests 1441. media ready made staphylococcus identification kit with combination of 12 tests 1442. media ready made transport swab cary blair veg 1443. media ready made transport swab stuart 1444. media ready made transport swab thioglycolllate medium veg 1445. media ready made wilson & blair agar plate 1446. media ready made xld agar plate 1447. media bile salt agar veg 1448. media dehydrated powder chrom candida differential agar veg 1449. media dehydrated powder brain heart infusion agar veg 1450. media dehydrated powder brain heart infusion broth veg 1451. media dehydrated powder deoxycholate citrate agar veg 1452. media dehydrated powder dnase test agar base veg 1453. media dehydrated powder glucose broth veg 1454. media dehydrated powder mac conkey agar veg 1455. media dehydrated powder mac conkey agar with crystal violet , nacl & with 0.15% bile salts veg 1456. media dehydrated powder mac conkey broth ( double strength ) with neutral red veg 1457. media dehydrated powder mannitol salt agar veg 1458. media dehydrated powder meat extract with peptone 1459. media dehydrated powder motility test medium 1460. media dehydrated powder mueller hinton agar veg 1461. dehydrated powder nitrate agar 1462. media dehydrated powder nutrient agar veg 1463. media dehydrated powder nutrient agar, 1.5% veg 1464. media dehydrated powder nutrient broth veg 1465. media dehydrated powder of basal medium veg 1466. media dehydrated powder of basal medium veg 1467. media dehydrated powder peptone bacteriological veg 1468. media dehydrated powder peptone water veg 1469. media dehydrated powder peptone water veg 1470. media dehydrated powder phenyalanine agar veg 1471. media dehydrated powder saborauds dextrose agar veg 1472. media dehydrated powder saborauds dextrose agar modified ( emmons ) + cc supplement veg 1473. media dehydrated powder saborauds dextrose broth veg 1474. media dehydrated powder salmonella shigella agar veg 1475. media dehydrated powder sensitivity test medium 1476. media dehydrated powder simmons citrate agar veg 1477. media dehydrated powder sodium deoxycholate veg 1478. media dehydrated powder sodium taurocholate veg 1479. media dehydrated powder specimen preservative medium base 1480. media dehydrated powder sugar with ph indicator adonitol veg 1481. media dehydrated powder sugar with ph indicator arabinose veg 1482. media dehydrated powder sugar with ph indicator cellobiose veg 1483. media dehydrated powder sugar with ph indicator dextrose veg 1484. media dehydrated powder sugar with ph indicator dulcitol veg 1485. media dehydrated powder sugar with ph indicator fructose veg 1486. media dehydrated powder sugar with ph indicator galactose veg 1487. media dehydrated powder sugar with ph indicator inositol veg 1488. media dehydrated powder sugar with ph indicator inulin veg 1489. media dehydrated powder sugar with ph indicator lactose veg 1490. media dehydrated powder sugar with ph indicator maltose veg 1491. media dehydrated powder sugar with ph indicator mannitol veg 1492. media dehydrated powder sugar with ph indicator mannose veg 1493. media dehydrated powder sugar with ph indicator mellibiose veg 1494. media dehydrated powder sugar with ph indicator raffinose veg 1495. media dehydrated powder sugar with ph indicator rhamnose veg 1496. media dehydrated powder sugar with ph indicator ribose veg 1497. media dehydrated powder sugar with ph indicator salicin veg 1498. media dehydrated powder sugar with ph indicator sorbitol veg 1499. media dehydrated powder sugar with ph indicator sucrose veg 1500. media dehydrated powder sugar with ph indicator trehalose veg 1501. media dehydrated powder sugar with ph indicator xylose veg 1502. media dehydrated powder taurocholate broth veg 1503. media dehydrated powder tb broth base veg 1504. media dehydrated powder tb broth base with tween 80 veg 1505. media dehydrated powder tcbs agar veg 1506. media dehydrated powder tcbs agar veg 1507. media dehydrated powder tellurite blood agar base 1508. media dehydrated powder tellurite blood agar base+ hemoglobin powder + vitamino growth supplement + potassium tellurite 1% ( 1ml per vial ) veg 1509. media dehydrated powder tetrathionate brilliant green bile broth 1510. media dehydrated powder tetrazolium reduction medium 1511. media dehydrated powder thayer martin medium base veg 1512. media dehydrated powder thayer martin medium base + hemoglobin powder + gc supplement with antibiotics + vitamino growth supplement + vcn supplement + vcnt supplement veg 1513. media dehydrated powder thioglycollate agar 1514. media dehydrated powder thioglycollate medium with heamin & vitamin k veg 1515. media dehydrated powder transport cary blair medium without charcoal veg 1516. media dehydrated powder transport stuart medium veg 1517. media dehydrated powder triple sugar iron agar veg 1518. media dehydrated powder tryptone glucose beef extract agar 1519. media dehydrated powder urea agar base ( christensen ) veg 1520. media dehydrated powder urea agar base ( christensen ) veg 1521. media dehydrated powder urea agar base ( christensen ) + urea 40% ( 5ml per vial ) veg 1522. media dehydrated powder urea agar base ( christensen ) + urea 40% ( 5ml per vial ) veg 1523. media dehydrated powder urea broth base ( christensen ) 1524. media dehydrated powder urea broth base ( christensen ) 1525. media dehydrated powder wilson & blair agar base veg 1526. media dehydrated powder wilson & blair agar with brilliant green veg 1527. media dehydrated powder xylose lysine deoxycholate agar veg 1528. media potassium tellurite 1% ( 1ml per vial ) veg 1529. media ready made blood culture bottle for peadiatric ( small ) fluid thioglycollate medium with 0.05 % sps 1530. media ready made blood culture bottle for adult ( large ) brain heart infusion broth with 0.05 % sps 1531. media ready made blood culture bottle for peadiatric ( small ) brain heart infusion broth with 0.05 % sps 1532. media ready made blood culture bottle for adult ( large ) hartleys broth with 0.05 % sps 1533. media ready made blood culture bottle for peadiatric ( small ) hartleys broth with 0.05 % sps 1534. media ready made blood culture bottle for adult ( large ) columbia broth 1535. media ready made blood culture bottle for peadiatric ( small ) columbia broth 1536. media ready made blood culture bottle for adult ( large ) fluid thioglycollate medium with 0.05 % sps veg 1537. media ready made blood culture bottle for peadiatric ( small ) fluid thioglycollate medium with 0.05 % sps 1538. media ready made blood culture bottle biphasic for adult ( large ) 1539. media ready made blood culture bottle biphasic for peadiatric ( small ) 1540. media ready made blood culture bottle biphasic for peadiatric ( small ) for for salmonella xld veg 1541. media dehydrated powder c.l.e.d agar with andrade indicator 1542. mr vp medium ( dehydrated ) veg 1543. potato dextrose agar veg 1544. selenite f broth with dulcitol 1545. tryptone soya agar 1546. tryptone soya broth 1547. trypticase soya agar 1548. trypticase soya broth 1549. yeast nitrogen base ( dehydrated ) veg 1550. tryptic soy broth with bromo cresol purple 1551. atcc strain acinetobacter baumannii 19606 1552. atcc strain acinetobacter baumannii baa 747 1553. atcc strain acinetobacter lwoffii 15309 1554. atcc strain aspergillus niger 16404 1555. atcc strain aspergillus niger 16888 1556. atcc strain bacillus atrophaeus 9372 1557. atcc strain bacillus cereus 10876 1558. atcc strain bacillus subtilis sp subtilis 11774 1559. atcc strain candida albicans 90028 1560. atcc strain candida albicans 90028 1561. atcc strain candida albicans 10231 1562. atcc strain candida albicans 10231 1563. atcc strain candida parapsilosis 22019 1564. atcc strain candida tropicalis 750 1565. atcc strain candida krusei 6258 1566. atcc strain candida krusei 14243 1567. atcc strain candida glabrata 15126 1568. atcc strain candida gullermondii 6260 1569. atcc strain candida kefyr 204093 1570. atcc strain citrobacter fruendii 43864 1571. atcc strain citrobacter koseri 27156 1572. atcc strain clostridium difficile 9689 1573. atcc strain clostridium perfringens 13124 1574. atcc strain corynebacteriae diphtheriae 13812 1575. atcc strain cryptococcus neoformans 14116 1576. atcc strain cryptococcus neoformans 204092 1577. atcc strain enterobacter aerogenes 13048 1578. atcc strain enterococcus fecalis 29212 1579. atcc strain enterococcus fecalis 51299 1580. atcc strain enterococcus feacium 27270 1581. atcc strain e.coli 25922 1582. atcc strain e.coli 35218 1583. atcc strain geobacillus stearothermophilus 7953 1584. atcc strain hemophillus influenzae 49247 1585. atcc strain hemophillus influenzae 49766 1586. atcc strain klebsiella oxytoca 43086 1587. atcc strain klebsiella pneumoniae 700603 1588. atcc strain klebsiella pneumoniae baa 1705 1589. atcc strain klebsiella pneumoniae baa 1706 1590. atcc strain morganella morganii 25829 1591. atcc strain mycobacteruim tuberculosis 25177 1592. atcc strain mycoplasma hominis 15488 1593. atcc strain n. gonorrhoea 49226 1594. standard strain n. gonorrhoea who e 1595. standard strain n. gonorrhoea who c 1596. standard strain n. gonorrhoea nctc 10026 1597. standard strain n. gonorrhoea nctc 8554 1598. atcc strain n. meningitidis 13077 1599. atcc strain n. meningitidis 13090 1600. atcc strain proteus mirabilis 25933 1601. atcc strain proteus vulgaris 49132 1602. atcc strain provedentia alkalifaciens 51902 1603. atcc strain provedentia retgeri 9250 1604. atcc strain provedentia stuartii 33672 1605. atcc strain pseudomonas aeruginosa 27853 1606. atcc strain pseudomonas aeruginosa 27983 1607. atcc strain pseudomonas aeruginosa cp99 24 1608. atcc strain salmonella enterica subspp enterica serovar cholerasuis 10708 1609. atcc strain salmonella enterica subspp enterica serovar cholerasuis 7001 1610. atcc strain salmonella enterica subspp enterica serovar paratyphi a 9150 1611. atcc strain salmonella enterica subspp enterica serovar paratyphi b baa1250 / spb7 1612. atcc strain salmonella enterica subspp enterica serovar typhimurium 51812 1613. atcc strain salmonella enterica subspp enterica serovar typhimurium 13311 1614. atcc strain serratia marcescens 13880 1615. atcc strain shigella sonnei 25931 1616. atcc strain staphylococcus aureus 25923 1617. atcc strain staphylococcus aureus 29213 1618. atcc strain staphylococcus aureus 43300 1619. atcc strain staphylococcus aureus 13709 1620. atcc strain staphylococcus aureus baa 976 1621. atcc strain staphylococcus aureus baa 1708 1622. atcc strain staphylococcus epidermidis 12228 1623. atcc strain staphylococcus lugduneneis 49578 1624. atcc strain staphylococcus saprophyticus 49453 1625. atcc strain sternotrophomonas maltophila 13637 1626. atcc strain streptococcus agalactiae 12386 1627. atcc strain streptococcus pneumoniae 49619 1628. atcc strain streptococcus pneumoniae 10015 1629. atcc strain streptococcus pyogenes 19615 1630. atcc strain streptococcus pyogenes 12384 1631. atcc strain trichophyton mentagrophytes 9533 1632. atcc strain trichophyton rubrum 28188 1633. atcc strain vibrio cholerae baa 2163 1634. atcc strain vibrio cholerae 39315 1635. atcc strain vibrio cholerae 39415 1636. atcc strain vibrio alginolyticus 17749 1637. nctc strain vibrio furnissii 11218 1638. atcc strain vibrio parahemolyticus 17802 1639. atcc strain yersinia enterocolica susp enteroclitica 23715 1640. brucella agar base with hemin & vit.k 1641. sheep blood agar veg 1642. sheep chocolate agar veg 1643. tryptic soya agar supplemented with yeast extract, vit.k&hemin veg 1644. bacteroids bile esculin agar base veg 1645. egg yolk agar base veg 1646. egg yolk emulsion veg 1647. phenyl ethyl alcohol agar veg 1648. thioglycolate medium with hemin & vit.k veg 1649. anaerobic gas pack 1650. anaerobic indicator tablet 1651. anaerobic bag system 1652. vitamin k supplement veg 1653. sterile swab stick with sterile test tube containing media ( amies without charcol ) 1654. swab stick plastic without testtube, sterile 1655. sterile swab stick in test tube sterile ( locked ) 1656. swab stick 1657. swab cotton bud 1658. swab cotton bud 1659. corn meal agar veg 1660. corn meal agar veg 1661. robertsons cooked meat broth veg 1662. robertsons cooked meat broth veg 1663. ornithine decarboxylate broth veg 1664. lysine decarboxylate broth veg 1665. lysine decarboxylate broth veg 1666. arginine dehydrolase broth veg 1667. candida agar for differentiation of candida albicans veg 1668. sheep blood 1669. horse blood 1670. aliquottes / microcentrifuge tubes 1671. aliquottes / microcentrifuge tubes 1672. aliquottes / microcentrifuge tubes 1673. aliquottes / microcentrifuge tubes 1674. alluminium rack for sv2 1675. alluminium rack for sv2 1676. aluminium baskets for test tubes 1677. aluminium rack for test tubes ( 10 rows each of 10 holes ) 1678. aluminium rack for test tubes ( 10 rows each of 10 holes ) 1679. aluminium rack for test tubes ( 5 rows each of 20 holes ) 1680. aluminium rack for test tubes ( 5 rows each of 20 holes ) 1681. aluminium tray to carry slides 1682. aluminum rack for test tubes ( 3 rows each of 8 holes ) 1683. aluminum rack for test tubes ( 3 rows each of 8 holes ) 1684. aluminum rack for test tubes ( 5 rows each of 10 holes ) 1685. aluminum rack for test tubes ( 5 rows each of 10 holes ) 1686. auto pipette – fixed volume 5 μl 1687. auto pipette – fixed volume 20 μl 1688. auto pipette – fixed volume 25 μl 1689. auto pipette – fixed volume 100 μl 1690. auto pipette – fixed volume 500 μl 1691. auto pipette – fixed volume 5000 μl 1692. auto pipette – variable volume 2 to 20 μl 1693. auto pipette – variable volume 20 to 200 μl 1694. auto pipette – variable volume 200 to 1000 μl 1695. auto pipette – variable volume 5 to 50 μl 1696. basket for test tubes 1697. barrier slides 1698. borosil glass beaker 1699. borosil glass beaker 1700. borosil glass beaker 1701. borosil glass beaker 1702. borosil glass beaker 1703. borosil glass beaker 1704. beaker plastic autoclavable 1705. beaker plastic autoclavable 1706. beaker plastic autoclavable 1707. beaker plastic autoclavable 1708. beaker plastic autoclavable 1709. beaker plastic autoclavable 1710. beaker plastic autoclavable 1711. bottles for blood culture glass , with aluminium cap 1712. bottles for blood culture glass , with aluminium cap 1713. bottles for blood culture glass , with aluminium cap bakelite cap 1714. bottles for blood culture glass , with aluminium cap bakelite cap 1715. candle jar 1716. candle jar 1717. capillary tubes 1718. conical flask glass autoclavable, without screwcap 1719. conical flask glass autoclavable, without screwcap 1720. conical flask glass autoclavable, without screwcap 1721. conical flask glass autoclavable, without screwcap 1722. conical flask glass autoclavable, without screwcap 1723. conical flask glass autoclavable, without screwcap 1724. conical flask glass autoclavable, without screwcap 1725. conical flask glass autoclavable, with screwcap 1726. conical flask glass autoclavable, with screwcap 1727. conical flask glass autoclavable, with screwcap 1728. conical flask glass autoclavable, with screwcap 1729. conical flask glass autoclavable, with screwcap 1730. conical flask glass autoclavable, with screwcap 1731. conical flask glass autoclavable, with screwcap 1732. coplin jars horizontal ( 10 grooves with lids ) 1733. coplin jars vertical ( 5 grooves with lids ) 1734. coverglass 18 x 18 mm 1735. coverglass 22 x 22 mm 1736. coverglass 22 x 30 mm 1737. coverglass 22 x 40 mm 1738. coverglass 22 x 50 mm 1739. discarding jar with lid 1740. discarding jar with lid 1741. discarding jar with lid 1742. discarding jar with lid 1743. dropping bottle 1744. digital thermometer ( 10deg.c to 100deg. c ) 1745. slide holding racks 5 1no. / packet 1746. slide staining racks 5 1no. / packet 1747. slide boxes of capacity 25 / pkt 1748. slide boxes of capacity 50 / pkt 1749. slide boxes of capacity 100 / pkt 1750. flask ( flat bottom ) 1751. flask ( flat bottom ) 1752. flask ( flat bottom ) 1753. flask ( flat bottom ) 1754. flask ( flat bottom ) 1755. flask ( flat bottom ) 1756. flat bottle 1757. funnel glass 1758. funnel glass 1759. funnel ( plastic ) 1760. funnel ( plastic ) 1761. glass bulb for blood brown with rubber stopper 1762. glass container with lid, round mouth 1763. glass container with lid, round mouth 1764. glass cuvettes ( thick borosilicate glass only ) 1765. hb set ( sahlis acid hematin apparatus ) 1766. koplin jar 1767. measuring cylinder 1768. measuring cylinder 1769. measuring cylinder 1770. measuring cylinder 1771. measuring cylinder 1772. measuring cylinder 1773. museum jars 1774. museum jars 1775. museum jars 1776. museum jars 1777. neubauer chamber improved 1778. pasteur pipettes with latex rubber teats 1779. pasture pipettes with rubber teats 1780. petri dish autoclavable transparent plastic 1781. petri dish autoclavable transparent plastic 1782. petri dish autoclavable transparent plastic 1783. petri dish glass 1784. petri dish glass 1785. petri dish gamma sterile, disposable transparent plastic 1786. petri dish gamma sterile, disposable transparent plastic 1787. petri dish gamma sterile, disposable transparent plastic 1788. petri dish gamma sterile, disposable transparent plastic 1789. petri dish gamma sterile, disposable transparent plastic 1790. pipette 5 ml volumetric 1791. plastic vials 1792. plastic wash bottles with tube connected 1793. polypropylene centrifuge tubes 1794. polystyrene sample cups ( 1.5 ml ) 1795. polystyrene sample cups ( 3 ml ) 1796. pre heparinized syringe for abg analysis 1797. pvc test tube rack ( 4 rows each of 12 holes ) 1798. pvc test tube rack ( 4 rows each of 12 holes ) 1799. pvc test tube rack ( 4 rows each of 12 holes ) 1800. rack for glass pipettes 1801. rbc pipette 1802. refrigerator rack with cover for 0.5 ml aliquottes / microtubes 1803. refrigerator rack with cover for 1.5 ml aliquottes / microtubes 1804. serum storage tubes / secondary tubes with caps 1805. slide concave 1806. slide tray aluminium 1807. slide tray steel 30x30 cms 1808. slide tray steel 45x30 cms 1809. slide trough for staining 1810. slide plain 1811. spirit lamp 1812. stand for auto pipettes 1813. storage rack for glass pipettes 1814. test tube round bottom 1815. test tube glass autoclavable 1816. test tube glass autoclavable 1817. test tube glass autoclavable 1818. test tube glass, bakelite screw cap 1819. test tube glass, kahn, autoclavable 1820. test tube glass, wasserman, autoclavable 1821. test tube round bottom 1822. test tube round bottom 1823. test tubes 12x100 mm ( thick borosilicate glass only ) 1824. test tubes 18x150 mm ( thick borosilicate glass only ) 1825. test tubes 12x75 mm ( thick borosilicate glass only ) 1826. test tubes 12x75 mm, flat bottom ( thick borosilicate glass only ) 1827. tubes with stopper having wings 1828. glass tube ( microcubs ) 1829. urinometer 1830. volumetric flask ( 500 ml ) 1831. wash bottle glass or autoclavable plastic with rubber lid 1832. wbc pipette 1833. wintrobes tubes 1834. wire basket for test tubes 1835. urine collection jar 1836. urine container 1837. urine dipstix 1838. westergren esr tube 1839. esr stand 1840. hb pippette 1841. eye piece for microscope 1842. hb square tube 1843. sahlis hemoglobinometer 1844. micro pipette 5μl 1845. micro pipette 10μl 1846. micro pipette 20μl 1847. micro pipette 50 μl 1848. micro pipette 5ml 1849. micro pipette 10 50μl 1850. micro pipette 20 100μl 1851. micro pipette 50 500μl 1852. micro pipette 100 1000μl 1853. centrifuge tube ( red cap ) 1854. hand lens 1855. widal tube ( drayer ) 1856. widal tube ( conical tube ) 1857. anaerobic system 1858. petri plate carrier 1859. test tube carrier 1860. assorted calibrated nichrome loops 1861. metal loop holders 1862. microscopic slides with one end frosted ( corner 90° ) 1863. autoclavable, screw caped bottle with rubber diaphragm 1864. autoclavable, screw caped bottle 1865. wide mouthed glass jars of capacity 500gm with steel caps for viscera 1866. glass bottle with 20cc capacity with steel screw caps for preservation of blood 1867. wide mouthed plastic jar with plastic screw cap for viscera preservation 1868. wide mouthed plastic jar with plastic screw cap for viscera preservation 1869. wide mouthed plastic jar with plastic screw cap for viscera preservation 1870. wide mouthed plastic jar with plastic screw cap for viscera preservation 1871. wide mouthed plastic jar with plastic screw cap for viscera preservation 1872. wide mouthed plastic jar with plastic screw cap for viscera preservation 1873. wide mouthed plastic jar with plastic screw cap for viscera preservation 1874. empty broad neck glass bottle with cork size: 100ml 1875. empty broad neck glass bottle with cork size: 500ml 1876. specimen trasport container 1 ltr. 1877. specimen trasport container 2 ltr. 1878. specimen trasport container 3 ltr. 1879. specimen trasport container 5 ltr. 1880. metal buckets for centrifuge 1881. plastic slide box 1882. slide box plastic 1883. slide box plastic 1884. slide box wooden 1885. slide box wooden 1886. slide dryer 1887. adhesive stickers label 25 x 13 mm size 1888. adhesive stickers / labels ( 10mm x 22mm ) 1889. labels 1890. alluminium foil 1891. alluminium foil 1892. antibiotic zone scale 1893. antibiotic zone scale 1894. blotting paper sheet 1895. brush for test tube washing 1896. dimond marker pen 1897. disposable loop ( presterilized ) 1898. disposable loop ( presterilized ) 1899. disposable loop ( presterilized ) 1900. disposable loop ( presterilized ) 1901. disposable loop ( presterilized ) 1902. disposable loop ( presterilized ) 1903. disposable microtome knife for leica microtome ( 819 high profile ) 1904. disposable microtome knife for leica microtome ( 819 low profile ) 1905. filter microtips ( barrier ) 10 microliter 1906. filter microtips ( barrier ) 20 microliter 1907. filter microtips ( barrier ) 200 microliter 1908. filter microtips ( barrier ) 300 microliter 1909. filter microtips ( barrier ) 1000 microliter 1910. filter microtips ( barrier ) 5000 microliter 1911. filter paper whatman grade no. 1 1912. filter paper whatman grade no. 1 1913. filter paper whatman student grade 1914. filter paper whatman student grade 1915. glass marking pencil – red colour 1916. glass marking pencil – white colour 1917. diamond marker pen for marking on glass slide 1918. heat, acid, alkali resistant gloves ( size: 7 ) 1919. indicator strip for autoclave 1920. micro tip box with transparent cover ( for 10 μl tips ) 1921. micro tip box with transparent cover ( for 200 μl tips ) 1922. micro tip box with transparent cover ( for 1000 μl tips ) 1923. microtips 1924. microtips 1925. microtips 1926. microtips 1927. microtips 1928. microtips 1929. microtips 1930. microtips 1931. microtips 1932. microtips 1933. microtips 1934. microtips 1935. microtips 1936. microtips 1937. microtips 1938. microtips 1939. microtips 1940. microtips 1941. microtips 1942. microtips 1943. microtips 1944. microtips 1945. microtips 1946. microtips 1947. microtips 1948. microtips 1949. microtips 1950. microtips 1951. microtips 1952. microtips 1953. microtips 1954. microtips 1955. microtips 1956. microtips 1957. microtips 1958. microtips 1959. microtips 1960. microtips 1961. micrscope cable wires 1962. multipurpose clinical sample collector 1963. ohp marker pens 1964. paper roll for thermal printer 56 mm width 1965. permanent marker pen 1966. strips for estimating of albumin & glucose in urine 1967. glucostrips with glucometer ( one glucometer supply free with 1000 glucostrips strips ) 1968. ph indicator capsule for calibration of ph meter 1969. ph paper ( 0 6 ) 1970. ph paper ( 6.5 13 ) 1971. ph tablets of ph 4 1972. ph tablets of ph 7 1973. ph tablets of ph 9 1974. pipette stand 1975. pipette stand 1976. rack for vacuette , plastic 1977. rack for vacuette , plastic 1978. lens cleaning solution 1979. glass beads 1980. slide rinsing trough 1981. tissue capsule 1982. tourniquets for blood donation camps 1983. wire loop nichrome, double wound 1984. wire loop nichrome, double wound 1985. wire loop nichrome, double wound 1986. wire loop nichrome, double wound 1987. wire loop with handle changeable nicrome loop embedded in ss rod with heat resistant handle double wound 1988. asbestos gloves 1989. specimen jars glass with accompanying lids 1990. specimen jars glass with accompanying lids 1991. specimen jars glass with accompanying lids 1992. specimen jars glass with accompanying lids 1993. anti a sera 1994. anti b sera 1995. anti ab sera 1996. anti d sera 1997. anti d sera 1998. anti d sera 1999. anti d sera 2000. bovine albumin 2001. coomb’s sera 2002. coomb’s sera 2003. red cell antigen panel 2004. starter pack for preparing coomb’s control cell 2005. red cell preserving solution for serological applications 2006. negative control 2007. a panel of 3% reagent red blood cells 2008. anti – a1 sera 2009. anti – h sera 2010. cpda single bags ( 350ml ) for blood collection 2011. triple cpda blood collection bag with sagm ( 350ml ) 2012. triple cpda blood collection bag with sagm ( 450ml ) 2013. triple cpda blood collection bag without sagm ( 350ml ) 2014. triple cpda blood collection bag without sagm ( 450ml ) 2015. double blood collection bag with cpda 350 ml 2016. double blood collection bag with cpda 450 ml 2017. blood transfusion set 2018. biological indicator for autoclave contains bacillus stereothermophillus 2019. rare antibody detection disposable kit for gel agglutination system 2020. apheresis disposable kit 2021. temperature recording chart for platelet incubator helmer 2022. temperature recording chart for 80 deep freezer haier 2023. temperature recording chart for 2 8°c blood bag refrigerator haier 2024. temperature recording chart for platelet incubator penpol 2025. temperature recording chart for 2 6° c refrigerator terumopenpol 2026. temperature recording chart for 40° c refrigerator terumo penpol 2027. temperature recording chart for 2 6° c blood bag refrigerator jewette 2028. temperature recording chart for 40 deep freezer haier 2029. temperature recording chart for 40 deep freezer elbenton 2030. temperature chart for remi refrigerator 2031. lancet 2032. safety lancets with retracting needle 2033. waffers for sterile tube connecting device 2034. tips stand 2035. screening cell ( 3 panel cell ) 2036. cuvatte for haemoque 2037. paper bags to breathe 2038. graph marker ink pen for thermal chart 2039. graph marker ink pen for thermal chart 2040. cuvette for semi automated coagglutination 2041. column agglutination testsystem with card, liss solution, incubator ¢rifuge etc: 2042. column agglutination testsystem for screening ofunexpectedantibody 2043. antibody identificationeleven cells panel 2044. antibody identification twenty cells panel 2045. apheresis kit for sdp single needle ( fresenius ) closed system 2046. apheresis kits for tpe ( fresenius ) closed system 2047. lab side leukocyte depletion filter 2048. top and top blood bag 2049. blood grouping and cross mathing card for column agglutination technique 2050. top and bottom blood bag 2051. cuso4, 5h2o 2052. kit anti hiv 1 & 2 antibody & p24 ag detection kit 2053. kit anti hiv 1 & 2 antibody detection kit 2054. kit hbsag ( hepatitis b surface antigen ) 2055. kit rpr test for syphilis with all accessories ( white cards as per number of tests ) 2056. kit rpr test for syphilis with all accessories ( white cards as per number of tests ) 2057. kit anti hcv antibody 2058. kit anti hbs antibody 2059. kit anti hbs antibody 2060. kit anti hbs antibody 2061. hematology quality control ( trilevel 16 parameter 6x3ml per unit ) compatable for 3 part abacus cell counter 2062. printer roll for cell counter for 3 part ( abacus ) ( thermal printer ) 2063. software label printer roll 2064. elisa test for treponemal antibodies ( igg, igm, iga ) ( third generation ) 2065. kit anti hiv 1 & 2 antibody ( rapid ) 2066. kit anti hiv 1 & 2 antibody ( rapid ) 2067. kit anti hcv antibody 2068. nacl powder 2069. pan malaria card 2070. kahns test tubes borosilicate 2071. distilled water 2072. wafers for tscd 2073. base molds for embedding rings 2074. base molds for embedding rings 2075. base molds for embedding rings 2076. base molds for embedding rings 2077. embedding ring 2078. azure b dye powder 2079. basic fuschin powder 2080. deionized water for laboratory use...

Health And Family Welfare Department - Gujarat

26139615 supply of laboratory items (1 to 2230) part 5 (item no 1401 to 1750) 1. corn meal agar veg 2. corn meal agar veg 3. robertsons cooked meat broth veg 4. robertsons cooked meat broth veg 5. ornithine decarboxylate broth veg 6. lysine decarboxylate broth veg 7. lysine decarboxylate broth veg 8. arginine dehydrolase broth veg 9. candida agar for differentiation of candida albicans veg 10. sheep blood 11. horse blood 12. aliquottes / microcentrifuge tubes 13. aliquottes / microcentrifuge tubes 14. aliquottes / microcentrifuge tubes 15. aliquottes / microcentrifuge tubes 16. alluminium rack for sv2 17. alluminium rack for sv2 18. aluminium baskets for test tubes 19. aluminium rack for test tubes (10 rows each of 10 holes) 20. aluminium rack for test tubes (10 rows each of 10 holes) 21. aluminium rack for test tubes (5 rows each of 20 holes) 22. aluminium rack for test tubes (5 rows each of 20 holes) 23. aluminium tray to carry slides 24. aluminum rack for test tubes (3 rows each of 8 holes) 25. aluminum rack for test tubes (3 rows each of 8 holes) 26. aluminum rack for test tubes (5 rows each of 10 holes) 27. aluminum rack for test tubes (5 rows each of 10 holes) 28. auto pipette – fixed volume 5 μl 29. auto pipette – fixed volume 20 μl 30. auto pipette – fixed volume 25 μl 31. auto pipette – fixed volume 100 μl 32. auto pipette – fixed volume 500 μl 33. auto pipette – fixed volume 5000 μl 34. auto pipette – variable volume 2 to 20 μl 35. auto pipette – variable volume 20 to 200 μl 36. auto pipette – variable volume 200 to 1000 μl 37. auto pipette – variable volume 5 to 50 μl 38. basket for test tubes 39. barrier slides 40. borosil glass beaker 41. borosil glass beaker 42. borosil glass beaker 43. borosil glass beaker 44. borosil glass beaker 45. borosil glass beaker 46. beaker plastic autoclavable 47. beaker plastic autoclavable 48. beaker plastic autoclavable 49. beaker plastic autoclavable 50. beaker plastic autoclavable 188. beaker plastic autoclavable 189. beaker plastic autoclavable 190. bottles for blood culture glass , with aluminium cap 191. bottles for blood culture glass , with aluminium cap 192. bottles for blood culture glass , with aluminium cap bakelite cap 193. bottles for blood culture glass , with aluminium cap bakelite cap 194. candle jar 195. candle jar 196. capillary tubes 197. conical flask glass autoclavable, without screwcap 198. conical flask glass autoclavable, without screwcap 199. conical flask glass autoclavable, without screwcap 200. conical flask glass autoclavable, without screwcap 201. conical flask glass autoclavable, without screwcap 202. conical flask glass autoclavable, without screwcap 203. conical flask glass autoclavable, without screwcap 204. conical flask glass autoclavable, with screwcap 205. conical flask glass autoclavable, with screwcap 206. conical flask glass autoclavable, with screwcap 207. conical flask glass autoclavable, with screwcap 208. conical flask glass autoclavable, with screwcap 209. conical flask glass autoclavable, with screwcap 210. conical flask glass autoclavable, with screwcap 211. coplin jars horizontal (10 grooves with lids) 212. coplin jars vertical ( 5 grooves with lids ) 213. coverglass 18 x 18 mm 214. coverglass 22 x 22 mm 215. coverglass 22 x 30 mm 216. coverglass 22 x 40 mm 217. coverglass 22 x 50 mm 218. discarding jar with lid 219. discarding jar with lid 220. discarding jar with lid 221. discarding jar with lid 222. dropping bottle 223. digital thermometer ( 10deg.c to 100deg. c) 224. slide holding racks 5 1no./packet 225. slide staining racks 5 1no./packet 226. slide boxes of capacity 25/pkt 227. slide boxes of capacity 50/pkt 228. slide boxes of capacity 100/pkt 229. flask (flat bottom ) 230. flask (flat bottom ) 231. flask (flat bottom ) 232. flask (flat bottom ) 233. flask (flat bottom ) 234. flask (flat bottom ) 235. flat bottle 236. funnel glass 237. funnel glass 238. funnel (plastic) 239. funnel (plastic) 240. glass bulb for blood brown with rubber stopper 241. glass container with lid, round mouth 242. glass container with lid, round mouth 243. glass cuvettes (thick borosilicate glass only) 244. hb set( sahlis acid hematin apparatus) 245. koplin jar 246. measuring cylinder 247. measuring cylinder 248. measuring cylinder 249. measuring cylinder 250. measuring cylinder 251. measuring cylinder 252. museum jars 253. museum jars 254. museum jars 255. museum jars 256. neubauer chamber improved 257. pasteur pipettes with latex rubber teats 258. pasture pipettes with rubber teats 259. petri dish autoclavable transparent plastic 260. petri dish autoclavable transparent plastic 261. petri dish autoclavable transparent plastic 262. petri dish glass 263. petri dish glass 264. petri dish gamma sterile, disposable transparent plastic 265. petri dish gamma sterile, disposable transparent plastic 266. petri dish gamma sterile, disposable transparent plastic 267. petri dish gamma sterile, disposable transparent plastic 268. petri dish gamma sterile, disposable transparent plastic 269. pipette 5 ml volumetric 270. plastic vials 271. plastic wash bottles with tube connected 272. polypropylene centrifuge tubes 273. polystyrene sample cups (1.5 ml) 274. polystyrene sample cups (3 ml) 275. pre heparinized syringe for abg analysis 276. pvc test tube rack (4 rows each of 12 holes) 277. pvc test tube rack (4 rows each of 12 holes) 278. pvc test tube rack (4 rows each of 12 holes) 279. rack for glass pipettes 280. rbc pipette 281. refrigerator rack with cover for 0.5 ml aliquottes / microtubes 282. refrigerator rack with cover for 1.5 ml aliquottes / microtubes 283. serum storage tubes / secondary tubes with caps 284. slide concave 285. slide tray aluminium 286. slide tray steel 30x30 cms 287. slide tray steel 45x30 cms 388. slide trough for staining 389. slide plain 390. spirit lamp 391. stand for auto pipettes 392. storage rack for glass pipettes 393. test tube round bottom 394. test tube glass autoclavable 395. test tube glass autoclavable 396. test tube glass autoclavable 397. test tube glass, bakelite screw cap 398. test tube glass, kahn,autoclavable 399. test tube glass, wasserman,autoclavable 400. test tube round bottom 401. test tube round bottom 402. test tubes 12x100 mm (thick borosilicate glass only) 403. test tubes 18x150 mm (thick borosilicate glass only) 404. test tubes 12x75 mm (thick borosilicate glass only) 405. test tubes 12x75 mm, flat bottom(thick borosilicate glass only) 406. tubes with stopper having wings 407. glass tube (microcubs) 408. urinometer 409. volumetric flask (500 ml) 410. wash bottle glass or autoclavable plastic with rubber lid 411. wbc pipette 412. wintrobes tubes 413. wire basket for test tubes 414. urine collection jar 415. urine container 416. urine dipstix 417. westergren esr tube 418. esr stand 419. hb pippette 420. eye piece for microscope 421. hb square tube 422. sahlis hemoglobinometer 423. micro pipette 5μl 424. micro pipette 10μl 425. micro pipette 20μl 426. micro pipette 50 μl 427. micro pipette 5ml 428. micro pipette 10 50μl 429. micro pipette 20 100μl 430. micro pipette 50 500μl 431. micro pipette 100 1000μl 432. centrifuge tube (red cap) 433. hand lens 434. widal tube ( drayer) 435. widal tube ( conical tube) 436. anaerobic system 437. petri plate carrier 80. test tube carrier 81. assorted calibrated nichrome loops 82. metal loop holders 83. microscopic slides with one end frosted (corner 90°) 84. autoclavable, screw caped bottle with rubber diaphragm 85. autoclavable, screw caped bottle 86. wide mouthed glass jars of capacity 500gm with steel caps for viscera 87. glass bottle with 20cc capacity with steel screw caps for preservation of blood 88. wide mouthed plastic jar with plastic screw cap for viscera preservation 89. wide mouthed plastic jar with plastic screw cap for viscera preservation 90. wide mouthed plastic jar with plastic screw cap for viscera preservation 91. wide mouthed plastic jar with plastic screw cap for viscera preservation 92. wide mouthed plastic jar with plastic screw cap for viscera preservation 93. wide mouthed plastic jar with plastic screw cap for viscera preservation 94. wide mouthed plastic jar with plastic screw cap for viscera preservation 95. empty broad neck glass bottle with cork size: 100ml 96. empty broad neck glass bottle with cork size: 500ml 97. specimen trasport container 1 ltr. 98. specimen trasport container 2 ltr. 99. specimen trasport container 3 ltr. 100. specimen trasport container 5 ltr. 101. metal buckets for centrifuge 102. plastic slide box 103. slide box plastic 104. slide box plastic 105. slide box wooden 106. slide box wooden 107. slide dryer 108. adhesive stickers label 25 x 13 mm size 109. adhesive stickers/ labels (10mm x 22mm) 110. labels 111. alluminium foil 112. alluminium foil 113. antibiotic zone scale 114. antibiotic zone scale 115. blotting paper sheet 116. brush for test tube washing 117. dimond marker pen 118. disposable loop (presterilized) 119. disposable loop (presterilized) 120. disposable loop (presterilized) 121. disposable loop (presterilized) 122. disposable loop (presterilized) 123. disposable loop (presterilized) 124. disposable microtome knife for leica microtome( 819 high profile) 125. disposable microtome knife for leica microtome(819 low profile) 126. filter microtips( barrier) 10 microliter 127. filter microtips( barrier) 20 microliter 128. filter microtips( barrier) 200 microliter 129. filter microtips( barrier) 300 microliter 130. filter microtips( barrier) 1000 microliter 131. filter microtips( barrier) 5000 microliter 132. filter paper whatman grade no. 1 133. filter paper whatman grade no. 1 134. filter paper whatman student grade 135. filter paper whatman student grade 136. glass marking pencil – red colour 137. glass marking pencil – white colour 138. diamond marker pen for marking on glass slide 139. heat, acid, alkali resistant gloves (size: 7) 140. indicator strip for autoclave 141. micro tip box with transparent cover (for 10 μl tips) 142. micro tip box with transparent cover (for 200 μl tips) 143. micro tip box with transparent cover (for 1000 μl tips) 144. microtips 145. microtips 146. microtips 147. microtips 148. microtips 149. microtips 150. microtips 151. microtips 152. microtips 153. microtips 154. microtips 155. microtips 156. microtips 157. microtips 158. microtips 159. microtips 160. microtips 161. microtips 162. microtips 163. microtips 164. microtips 165. microtips 166. microtips 167. microtips 168. microtips 169. microtips 170. microtips 171. microtips 172. microtips 173. microtips 174. microtips 175. microtips 176. microtips 177. microtips 178. microtips 179. microtips 338. microtips 339. microtips 340. micrscope cable wires 341. multipurpose clinical sample collector 342. ohp marker pens 343. paper roll for thermal printer 56 mm width 344. permanent marker pen 345. strips for estimating of albumin & glucose in urine 346. glucostrips with glucometer (one glucometer supply free with 1000 glucostrips strips) 347. ph indicator capsule for calibration of ph meter 348. ph paper (0 6) 349. ph paper (6.5 13) 350. ph tablets of ph 4 351. ph tablets of ph 7 352. ph tablets of ph 9 353. pipette stand 354. pipette stand 355. rack for vacuette , plastic 356. rack for vacuette , plastic 357. lens cleaning solution 358. glass beads 359. slide rinsing trough 360. tissue capsule 361. tourniquets for blood donation camps 362. wire loop nichrome, double wound 363. wire loop nichrome, double wound 364. wire loop nichrome, double wound 365. wire loop nichrome, double wound 366. wire loop with handle changeable nicrome loop embedded in ss rod with heat resistant handle double wound 367. asbestos gloves 368. specimen jars glass with accompanying lids 369. specimen jars glass with accompanying lids 370. specimen jars glass with accompanying lids 371. specimen jars glass with accompanying lids 372. anti a sera 373. anti b sera 374. anti ab sera 375. anti d sera 376. anti d sera 377. anti d sera 378. anti d sera 379. bovine albumin 380. coomb’s sera 381. coomb’s sera 382. red cell antigen panel 383. starter pack for preparing coomb’s control cell 384. red cell preserving solution for serological applications 385. negative control 386. a panel of 3% reagent red blood cells 387. anti – a1 sera ...

Health And Family Welfare Department - Gujarat

26046776 providing chemicals/glassware in m. p. shah govt. medical college, jamnagar.(prat 1 of 2) 358. methanol 359. methanol 360. dpx mountant for microscopy 361. dpx mountant for microscopy 362. xylene (sulphur free) 363. formalin soution 364. formalin soution 365. formalin soution 366. formalin soution 367. dettol antiseptic liquid 368. beakers 369. beakers 370. beakers 371. beakers 372. glass test tubes with conical bottom 373. glass petri dish with lid 374. wide mouth clear bottle 375. wide mouth clear bottle 376. copoline jar with lid 377. microscopic round cover glass (english glass) 378. 10 % naocl solution 379. 2,.2 dipyridyl pure 380. 2 4 dinitrophenyl hydrazine 381. 4 amino antipyrine 382. acetest reagent tablet 383. acetic acid 384. acetic acid glacial 385. acetone 386. acid ascorbic 387. acid benzoic 388. acid citric 389. acid hippuric 390. acid hydrochloric ar / gr 391. acid hydrochloric lr 392. acid lactic ( lithium salt) 393. acid molybdic 394. acid nitric ar/gr 395. acid phospho tungstic 396. acid picric 397. acid succinic acid lr 398. acid sulfuric ar/gr 399. acid sulfuric lr 400. acid sulphanilic. 401. acid sulphosalisylic 402. acid tartaric 403. acid trichloride ar/gr 404. acid trichloroacetic ar/gr 405. agarose powder 406. albumin fraction v human. 407. albumin standard 408. albumin(bovine) 409. albumin(flakes) 410. alcohol ethanol absolute 411. alcohol free disinfectant for blood collection procedure of skin disinfection 412. alcohol methanol extra pure 413. alcohol n butyl 414. alcohol propen 2 ol 415. amidoschwartz 10b powder 416. ammonia solution (liquid) 417. ammonical silver nitrate 418. ammonium chloride ar/gr 419. ammonium molybdate 420. ammonium sulphate 421. ammonium sulphate lr 422. ammonium thyocyanate 423. anesthetic ether 424. antimany trichoric 425. barbituric acid powder 426. barium chloride 427. barium hydroxide 428. benedict qualitative reagent 429. benzidine powder 430. benzidine pure 431. benzoic acid 432. bilirubin powder 433. bilirubin pure 434. borax powder 435. bovine albumin 436. bromine liquid 437. caffine powder 438. calcium chloride 439. casein 440. cellulose acetate strip 441. cetylpyridinium chloride 442. chloroform 443. cholesterol powder 444. chondroitin sulphate 445. citric acid 446. copper sulphate ar/gr 447. copper sulphate lr 448. costic soda 449. creatinine powder 450. cupric acetate 451. d xylose powder 452. dextrin 453. dextrose /d glucose 454. di.nitro phenyl hydrazine. 455. diacetyl monoxime. 456. diethyl ether 457. di sodium edta. 458. di sodium hydrogen phosphate. 459. di sodium phenyl phosphate 460. ditaurobilirubin powder 461. ferric chloride powder 462. fibrin 463. fibrinogen 464. formaldehyde 465. formalin solution 466. fructose 467. gelatin 468. glacial acitic acid 469. glucose ar/gr 470. glycerine 471. hydrogen peroxide 472. hypochloride solution 5% 473. indicator alpha nephthol 474. indicator bromo cresol green 475. indicator chlorophenol red 476. indicator metheline blue 477. indicator methyl red 478. indicator methyl violet 479. indicator phenphtheline 480. indicator thymol 481. indicator toffer’s reagent 482. iodine powder 483. iso propyl alcohol 484. lactose 485. l alanine. 486. lead acetate 487. maltose 488. mercuric sulphate 489. methanol. 490. methyl melonic acid 491. methyl violate 492. n butanol 493. ninhydrin powder 494. nitric acid 495. o phosphoric acid. 496. o toludine. 497. para bromo aniline. 498. parrafin wax 499. pepsin 500. peptone 501. petroleum ether 502. phenyl hydrazine hydrochloride powder 503. phloroglucinol 504. picric acid 505. p nitroaniline 506. potassium chloride 507. potassium dichromate 508. potassium dihydrogen phosphate. 509. potassium ferricynate 510. potassium iodide 511. potassium oxalate. 512. pottassium chromate 513. rennin 514. resorsinol 515. silver nitrate 516. sodium acetate 517. sodium acetate trihydrate 518. sodium azide 519. sodium barbitone powder 520. sodium benzoate 521. sodium bicarbonate. 522. sodium bile salt 523. sodium carbonate 524. sodium chloride anhydrous. 525. sodium citrate 526. sodium fluoride. 527. sodium hydroxide pellets 528. sodium hydroxide. 529. sodium hypobromide 530. sodium hypochlorite. 531. sodium molybdate 532. sodium nitrate 533. sodium nitrite ar / gr 534. sodium nitropruside. 535. sodium nitroprusside 536. sodium phosphate 537. sodium potassium tartrate 538. sodium sulphate. 539. sodium sulphite anhydrous. 540. sodium taurocholate 541. sodium tungstate. 542. starch soluble 543. sucrose 544. sulphanilic acid powder 545. sulphosalycilic acid 546. sulphur powder 547. thiosemi carbazide. 548. thiourea. 549. thymol crystals 550. toludine blue o 551. trisodium citrate 552. triton x 100 553. urea 554. urease powder 555. uri strips for glucose,protein, ketone body 556. uric acid 557. vanillin 558. auto pipette variable volume 559. auto pipette variable volume 560. auto pipette variable volume 561. auto pipettes disposable tips 562. auto pipettes disposable tips 563. auto pipettes disposable tips 564. auto pipettes of fixed volume 565. auto pipettes of fixed volume 566. auto pipettes of fixed volume 567. auto pipettes of fixed volume 568. auto pipettes of fixed volume 569. burette 570. calibrated weights 571. digital hygrometer (temperature & humidity meter) 572. digital temperature sensor 573. eppendrof cups 574. eppendrof cups 575. glass slide (80x60 mm) 576. graduated glass cylinder 577. microfuge tubes 1 ml with rack. 578. microfuge tubes 0.5 ml with rack. 579. microfuge tubes 1.5 ml with rack. 580. micropipette stand with tips holder 581. pipette 5ml graduated 582. plastic rack for test tubes 583. plastic rack for test tubes 584. plastic rack for test tubes 585. plastic syringe 586. pvc rack small 587. rack for tubes in abs plastic with or without handle, 588. rack for tubes in abs plastic with or without handle, 589. rack for tubes in abs plastic with or without handle, 590. refrigerator rack for microtubes 591. secondary tube for serum storage 592. stainless steel aluminium 593. storage rack for microtubes in acryllic box 594. test tube 595. test tube flat bottom 596. test tube rack peg type 597. test tube racks of 598. test tube stand 599. test tube without rim, trough glass for washing, round bottom 600. polythin beker non gratuated 601. glass dropper ( 30 cm long x 0.5 cm inner diameter ) ( 30 cm long x 0.75 cm inner diameter 602. hypocloride 603. sanitizer 604. glass bottle 605. soyabean casien digest 606. simmons citrate media 607. tcbs media 608. ss agar 609. bile esculin agar 610. saubrouds dextrose agar 611. sodium chloride powder 612. sodium torocholate powder 613. yeast extract 614. di sodium hydrogen sulphate 615. corn meal agar 616. sodium deoxycholate 617. methyl violet 618. iodine 619. crystal violet 620. muller hinton agar 621. mcconkey agar 622. beef extract powder 623. agar agar powder 624. peptone type 1 bacteriological 625. mannitol salt agar 626. glucose anhydrus 627. lactose powder 628. sucrose powder 629. mannitol powder 630. triple sugar iron 631. wilson & blair agar (ready to use) , m322 632. xld agar 633. andredes indicator 634. lactophenol cotton blue 635. indian ink 636. geimsa stain 637. basic fuschin stain 638. methylene blue 639. neutral red 640. methyl red 641. melachite green 642. briliant green 643. disodium hydrogen phosphate 644. sodium bicarbonate 645. barium chloride 646. koh pallets 647. naoh pallets 648. phenol crystals 649. potassium tellurite 650. methanol 651. glyserol 652. lactic acid 653. pottasium permanganate 654. ammonia 655. pottasium dichromate 656. disposable petri dish 90 mm good quality 657. disposable petri dish 100 mm good quality 658. urine container good quality 659. sputum container good quality 660. disposable loop 661. pus stick 662. spirit lamp aluminium (125mm) good quality 663. acid prrof plastic bucket with lids, good quality, 15 liter white/red 664. test tube(18mm x150 mm) 665. measuring cylinder (100ml) 666. measuring cylinder (500ml) 667. glass beaker (large) 668. funnels 200mm 669. 1000 μl sterile filter tips 670. 200 μl sterile filter tips 671. 20 μl sterile filter tips 672. 10 μl sterile filter tips 673. powder free nitrile gloves( for pcr) (m) & (s) size 674. sterilium 675. simple surgical mask 676. ethanol for (pcr) 677. isopropyl alcohol (for instruments) 678. hypochlorite 5% solution 679. liquid hand wash solution 680. (h2so4) sulphuric acid 681. hcl hydrochloric acid 682. formaline 683. di pottasium hydrogen phosphate 684. microglass slide (75 x25mm) 685. micro glass slide concavity slide 75x25 mm (1.3 to 1.5 mm thick / diameter of cavity approx. 15 mm) 686. cover slip (22x 22 mm) 687. cover slip (22x 25 mm) 688. cover slip (22x 50 mm) 689. cover slip (18x 18 mm) 690. test tube (12x 75 mm) 691. durhams tube 692. screw cap autoclaveble bottole(250 ml) 693. screw cap autoclaveble bottole (500 ml) 694. screw cap autoclaveble bottole (1 lit) 695. acetone 696. kovacs reagent(ready to use) 697. giemsa srain 698. alberts stain a and b ( ready to use ) 699. mc farland standard media 700. phenyl alenuin agar 701. cled agar 702. carbol fuschin powder 703. nutrient agar 704. sheep blood agar 705. glucose phosphate broth 706. glycerole buffer saline 707. ferric chlorite anhydrous 708. alpha nephthol 709. oxidase reagent 710. hydrogen peroxide 711. urea difco 712. mono pottasium phosphate 713. alkaline peptone water 714. bactophenol red 715. phenol red 716. yellow tips 20 μl 717. blue tips 1000μl 718. filter paper rough (50*70) 719. distilled water 720. single use plastic pasteur pipettes sterile individually packed 721. eppendorf tube (1.5 ml) 722. eppendorf tube (2.0 ml) 723. nuclease free water 724. cryovials (2.0ml) 725. immunoflorescence respirtaory syncitial virus –slide with adsorbed antigens , anti respirtaory syncitialvirus (rsv) (igm),ready to use reagents 726. immunoflorescence rubella virus slide with adsorbed antigens, anti rubella virus (igg), 727. immunoflorescence toxoplasma gondii –slide with adsorbed with protozoal smear at least 2fields, antitoxoplasma gondii (iga), 728. immunoflorescence toxoplasma gondii –slide with adsorbed with protozoal smear at least 2fields, antitoxoplasma gondii (igg), 729. immunoflorescence toxoplasma gondii –slide with adsorbed with protozoal smear at least 2fields, antitoxoplasma gondii (igm), 730. immunoflorescence varicella zoster virus –slide with adsorbed antigens , anti varicella zoster virus vzv (igm), 731. immunoflorescence varicella zoster virus –slide with adsorbed antigens , anti varicella zoster virus vzv (iga), 732. immunoflorescence varicella zoster virus –slide with adsorbed antigens , anti varicella zoster virus vzv (igg), 733. immunoflorescence mosaic chlamydia –slide with adsorbed antigens at least 2 fields, mosaicchlamydia trachomatis / c. pneumoniae (igm), 734. immunoflorescence mosaic: herpes simplex virus –slide with adsorbed antigens at least 2 fields, mosaicherpes simplex virus(hsv1/hsv2(igg), 735. immunoflorescence mosaic: herpes simplex virus –slide with adsorbed antigens at least 2 fields, mosaicherpes simplex virus(hsv1/hsv2(igm), 736. immunoflorescence epstein barr virus –slide with expressing cells , epstein barr virus ebvaviditytest (ca igg/ca igm/ebv ea/ebv na), 737. immunoflorescence to.r.c.h.profile –slide with adsorbed antigens for torch profile igg, 738. immunofluorescent assay for viral and bacteriapneumonia (legionella, mycoplasma, coxiella,chlamydia, adenovirus, respiratory syncitial virus,parainfluenza, influenza a and b) igmimmunofluorescent assay 739. immunofluorescent assay for viral and bacteriapneumonia (legionella, mycoplasma, coxiella,chlamydia, adenovirus, respiratory syncitial virus,parainfluenza, influenza a and b) igg immunofluorescentassay 740. kit for cd4/ cd8 close system bd facs calibur 741. kit hdv – igm –96 well elisa 742. kit hdv ag – 96 well elisa 743. kit – je virus– 96 well elisa serum/ csf can be used as sample. 744. kit – anti hbs titre 96 well elisa 745. pcr kit hcv one step rt pcr kit – 746. real time pcr based kit for dengue genotyping – 747. real time pcr kit hbv qualitative compatible with thermocycler qiagen 748. real time pcr kit hdv qualitative compatible with thermocycler qiagen 749. real time pcr kit hcv qualitative compatible with thermocycler qiagen 750. real time pcr kit hpv 6/11 compatible with thermocycler qiagen 751. real time pcr kit hpv 6/18 compatible with thermocycler qiagen 752. real time pcr kit hpv high risk quantitative compatible with thermocycler qiagen 753. real time pcr kit hpv high risk typing compatible with thermocycler qiagen 754. real time pcr kit hsv i& ii typing compatible with thermocycler qiagen 755. real time pcr kit nhs meningitidis nhs meningitidis 756. real time pcr kit – rotavirus compatible with thermocycler qiagen 757. real time pcr kit rotavirus/norovirus/astrovirus compatible with thermocycler qiagen 758. rna extraction kit qiagen , 50 test column based for extraction of rna from viruses in clinical samples 759. rna extraction kit qiagen , 2 x 50 test column based for extraction of rna from viruses in clinical samples 760. rna extraction kit qiagen , 250 test column based for extraction of rna from viruses in clinical samples 761. rna extraction kit for body fluids qiagen , 50 test column based for extraction of rna from viruses in clinical samples 762. dna extraction kit qiaamp dna blood mini kit 250 test /50 tests 763. dna extraction kit qiaamp dna purfiation from whole blood samples (250 reactions) 764. dna extraction kit for blood qiaamp dna purfiation from serum samples (250 reactions) 765. universal master mix for pcr for 1000 reactions 766. dna extraction kit for body fluids qiaamp dna purfiation from tissues (250 reactions) 767. immunotroll cells for quality control of cd 4 test (normal count cells) 60 tests 768. immunotroll cells for quality control of cd 4 test (low count cells) 60 tests 769. sample tubes for cd4 flow count test 3.5 ml capacity, 1x 150 no. 770. molecular biology grade microcentrifuge tubes 1.7ml capacity, 1000no. 771. prodin 300 preservative 50mol bottel 772. taqman universal master mix lt.with ung 5 ml sufficient for 200 reaction at 50 μl each ...

Anand Agriculture Unviersity - Gujarat

22282806 auction sale of dead stock scrap material crompton wallfan, voltas deep freezer, rt pcr system, spinwin microcentrifuge with rotor, systronic ph meter, veriti 96 w thermal cycler, millipore system with accessories, icematic iceflacker, vertical slab electrophoresis system, bpl refrigerator, micro ovan, remi cooling micro centifuge, gel documentation system, master cycler gradient pcr, gene pulser, immuni blot appratus, dna sequencer with power unit, ph meter orion, water quality analyzer....

Gujarat Cancer And Research Institute - Gujarat

19584685 rate contract for supply of laboratory glassware and plastic ware goods . 280 lithium heparin vacuatte 281 fine filter paper 282 paed.blood collection vacuate citrate 283 multipipette m4 repeater m4 284 stainless steel staining jar with lid 285 microcentrifuge tube 286 0.5 μl to 10 μl multichennel reference (8 channels) pipette 287 micropipettes 288 micropipettes 289 micropipettes 290 micropipettes 291 micropipettes 292 micropipettes 293 75cm² flask 294 25cm² flask 295 cell counting slides 296 qubit assay tubes 297 sterile nitrile gloves 298 sterile cell stainer (40μm) 299 pipette with microtube opener adapter 300 sterile dispoasble tissue culture pipettes (serological pipette) 301 all in one rack (stand) for multiple volume tubes (15ml,50ml, etc) 302 cell culture chamber with cover slide well) 303 sterile cell culture insert(pc/pe) , polycarbonate membrane (pc), polyester membrane (pe) 304 pasture pipette 305 test tube holding forceps 306 rubber pipette bulb 307 rubber pipette bulb 308 rubber pipette bulb 309 culture tubes glass 310 test tube cleaning brushes with white nylon rounded tuft bristles 311 test tube cleaning brushes with white nylon rounded tuft bristles 312 test tube cleaning brushes with white nylon rounded tuft bristles 313 test tube holding forceps 314 rubber pipette bulb 315 sodium citrate 2.7 ml vacuum collection tube 316 needle with safety lock/holders 317 edta vaccum tubes 318 edta vaccum tubes 319 edta vaccum tubes 320 esr 1.6 ml vaccum blood collection 321 sodium fluoride with edta vaccum blood collection tubes 322 plain clot activator vacuum tubes...

Health And Family Welfare Department - Gujarat

19431735 tender for providing chemicals / glassware in m. p. shah govt. medical college, jamnagar. ( prat 1 of 2 ) . 171 real time pcr kit rotavirus/norovirus/astrovirus compatible with thermocycler qiagen 174 rna extraction kit qiagen , 50 test column based for extraction of rna from viruses in clinical samples 175 rna extraction kit qiagen , 2 x 50 test column based for extraction of rna from viruses in clinical samples 176 rna extraction kit qiagen , 250 test column based for extraction of rna from viruses in clinical samples 177 rna extraction kit for body fluids qiagen , 50 test column based for extraction of rna from viruses in clinical samples 178 dna extraction kit qiaamp dna blood mini kit 250 test /50 tests 179 dna extraction kit qiaamp dna purfiation from whole blood samples (250 reactions) 180 dna extraction kit for blood qiaamp dna purfiation from serum samples (250 reactions) 181 universal master mix for pcr for 1000 reactions 182 dna extraction kit for body fluids qiaamp dna purfiation from tissues (250 reactions) 183 immunotroll cells for quality control of cd 4 test (normal count cells) 60 tests 184 immunotroll cells for quality control of cd 4 test (low count cells) 60 tests 185 sample tubes for cd4 flow count test 3.5 ml capacity, 1x 150 no. 186 molecular biology grade microcentrifuge tubes 1.7ml capacity, 1000no. 187 prodin 300 preservative 50mol bottel 188 taqman universal master mix lt.with ung 5 ml sufficient for 200 reaction at 50 μl each 189 cedar wood oil 190 liquid paraffin 191 d.p.x 192 histogel 193 ultra mount permanent mounting media(ih) 194 synthetic canada balsum 195 natural canada balsum 196 deionised water 197 eosin powder 198 eosin yellow powder(water soluble) 199 haematoxylin powder 200 h&e stain...

Health And Family Welfare Department - Gujarat

18146729 supply of laboratory item 1526 swab cotton bud 1527 swab cotton bud 1528 corn meal agar veg 1529 corn meal agar veg 1530 robertsons cooked meat broth veg 1531 robertsons cooked meat broth veg 1532 ornithine decarboxylate broth veg 1533 lysine decarboxylate broth veg 1534 lysine decarboxylate broth veg 1535 arginine dehydrolase broth veg 1536 candida agar for differentiation of candida albicans veg 1537 sheep blood 1538 horse blood 1539 aliquottes / microcentrifuge tubes 1540 aliquottes / microcentrifuge tubes 1541 aliquottes / microcentrifuge tubes 1542 aliquottes / microcentrifuge tubes 1543 alluminium rack for sv2 1544 alluminium rack for sv2 1545 aluminium baskets for test tubes 1546 aluminium rack for test tubes (10 rows each of 10 holes) 1547 aluminium rack for test tubes (10 rows each of 10 holes) 1548 aluminium rack for test tubes (5 rows each of 20 holes) 1549 aluminium rack for test tubes (5 rows each of 20 holes) 1550 aluminium tray to carry slides...

University Of Agriculture - Gujarat

17781176 supply of laboratory and farm instruments / apparatus / equipment etc. . 1. hot air oven 2. hot air oven 3. microwave oven 4. autoclave 5. bod incubator 6. distiled water unit 7. water bath 8. hot air oven 9. double beam u.v. 10. refrigerated high speed centrifuge 11. water bath with temperature control 12. uv transilluminator 13. microcentrifuge tubes mini centrifuge 14. hot air oven 15. incubator 16. centrifuge machine 17. water bath with ( digital ) 18. microwave oven 19. p.c.r 20. bacteriological incubator 21. hot air oven 22. horizontal laminar air flow 23. soxhlet apparatus 24. hot air oven 25. centrifuge 1. binocular microscope 2. microscope 3. compound microscope with photo micro graphic unit 4. fluorescence microscope other lab / farm equipments 1. plant sample grinding mill 2. air drier 3. solar photovotaic panel 4. oil and phytochemical extraction unit 5. vacuum cleaner 6. deep fat fryer 7. tray dryer balances, meters etc 1. digital electronic balance 2. moisture meter 3. electronic balance 4. flame photometer 5. hot plate 6. electric shaker 7. electric balance 8. electrical conductivity meter 9. ph meter 12. magnetic stirrer with hot plate 13. vortex mixer 14. uv visible spectro photometer 15. portable uv torch 16. magnetic homonezer 17. oxygen permiability tester 18. water vapor permeability tester...

Health And Family Welfare Department - Gujarat

13672115 purchase of instruments / equipments / chemicals / glasswares / kits / models etc. for microbiology department, 201 vaccum pump 202 vdrl rotator (rotary shaker) 203 vdrl rotator (rotary shaker) 204 vortex mixer 205 water bath 206 water bath 207 water bath 208 bact alert reflectance stanadards 209 ultra sonic cleaner for glass or pp test tubes 210 photoelectric colorimeter. 211 magnetic stirer / cyclomixer 212 water quality testing meter 213 agarose gel electrophoresis apparatus with power supply pack 214 electronic weighing machine, 0.1 mg – 210 gm 215 water purification system for clinical laboratory 216 metal distilled water plant 217 sharp container 218 multipurpose refrigerated centrifuge 219 refrigerated bench top microcentrifuge, capacity 24 32 tubes 220 refrigerated bench top microcentrifuge with rotors 221 turbidometer for serological test 222 water purification system 3 stage 223 gel doc 224 motor less magnetic stirrer 225 round magnetic string bar with pivot ring 226 octagon magnetic string bar 227 cross spin magnetic string bar 228 micro spin magnetic string bar 229 magnetic retreiver 230 thermocycler 231 flouroscent trinocular microscope 232 semi auto analyzer 233 donor couch 234 blood bank refrigerator 235 digital hemoglobinometer ( hemoglobin estimation) 236 blood collection monitor 237 blood bag tube sealers (table top) 238 blood bag tube sealers (portable) 239 sterile tubing weilder ( sterile connecting tube device) 240 refrigerated centrifuges (refrigerated floor model blood component separation centrifuge) 241 deep freezer ( 80oc) 242 deep freezer ( 40oc) 243 platelet incubator with agitator 244 laminar air flow cabinet 245 refrigerated water bath (cryobath) 246 electronic balance to weighing the blood bags. 247 cell counter 248 plasma thawing bath (dry 249 plasma thawing bath (wet) 250 digital double pan balance 251 plasma expresser (manual) 252 tube stripper 253 transport box (capacity: 20 25 lit) 254 transport box (capacity: 50 60 lit) 255 transport box (capacity: 70 80 lit) 256 transport bag (capacity 4 7 lit) 257 transport bag (capacity 8 12 lit) 258 transport bag (capacity 35 40 lit)...

Health And Family Welfare Department - Gujarat

13672103 purchase of instruments / equipments / chemicals / glasswares / kits / models etc. for microbiology department, 151 micropipette fixed volume 152 micropipette fixed volume 153 micropipette fixed volume 154 micropipette fixed volume 155 micropipette fixed volume 156 micropipette variable volume, multichannel 157 micropipette variable volume, single channel 158 micropipette variable volume, single channel 159 micropipette variable volume, single channel 160 micropipette variable volume, single channel 161 micropipette variable volume, single channel 162 micropipette variable volume, single channel 163 micropipette variable volume, single channel 164 micropipette variable volume, single channel 165 micropipette variable volume, single channel 166 micropipette variable volume, single channel 167 micropipette variable volume, single channel 168 micropipette variable volume, single channel 169 micropipette fixed volume 170 microscope binocular 171 microscope binocular, with dark ground attachment 172 microscope monocular 173 microscope dissecting 174 microscope trinocular 175 microtip holder rack 176 milk cooler 177 mini centrifuge for pcr tube strips 178 needle/syringe destroyer electronic 179 pcr cooler zero degree centigrade 180 pcr tube rack 181 pcr tube rack with cover 182 pcr work station 183 table top digital ph meter 184 portable ph meter 185 pharmacy refrigerator 186 refrigerated bench top microcentrifuge 187 refrigerated bench top microcentrifuge with rotors 188 refrigerator double door, frost free 189 refrigerator single door, frost free 190 repeating pipette system 191 tachometer 192 tachometer digital non contact type calibrated 193 thermo meter 194 thermo meter 195 thermo meter 196 thermo meter 197 thermo meter 198 thermo meter 199 tissue homogenizer 200 vaccum cleaner...

Health And Family Welfare Department - Gujarat

13672092 purchase of instruments / equipments / chemicals / glasswares / kits / models etc. for microbiology department, 101 calibration plate for real time pcr 102 calibration plate for real time pcr 103 calibration plate for real time pcr 104 centrifuge 16 tubes 105 centrifuge 8 tubes 106 centrifuge with brushless motor 107 centrifuge tubes with caps 108 chiller insulated ice box 109 co2 incubator 110 colony counter digital 111 deep freeze 112 deep freeze 113 densitometer 114 electrode set 115 electronic weighing machine 116 electrophoresis gel casting tray 117 electrophoresis gel casting tray 118 electrophoresis power supply unit 119 elisa plate reader 120 elisa plate washer 121 elisa printer 122 filter for elisa reader 123 filter for elisa reader 124 filter for elisa reader 125 gel comb set 126 halogen lamp 127 halogen lamp 128 halogen lamp 129 heating elements 130 heating elements 131 heating elements 132 horizontal gel electrophoresis unit 133 horizontal gel electrophoresis unit 134 hot air oven 135 hot air oven 136 hot air oven 137 incubator (non microprocessor) 138 incubator (non microprocessor) 139 incubator stainless steel 140 incubator stainless steel 141 incubator stainless steel 142 inspissator 143 lcd projector 144 metal loop holder 145 microcentrifuge 146 microcentrifuge 147 microcentrifuge 148 micropipette electronic 149 micropipette fixed volume 150 micropipette fixed volume...

Junagadh Agricultural University - Gujarat

13438920 purchase of scientific equipments 57. automated hematology analyzer 58. gel electrophoresis system with power supply 59. microcentrifuge 60. vortex mixer 61. deep freezer ( 80c ) 62. uv cabinet / pcr workstation 63. ultra high resolution microscope 64. real time pcr 65. refrigerated centrifuge 66. textural analyzer 67. direct shear apparatus ( buy back ) 68. triaxial test apparatus ( buy back ) 69. solar photo voltaic plant ( 50 kw ) 70. soxtherm automatic extraction system 71. fully automatic horizontal autoclave ( capacity: 425 ltr ) 72. silent generator 73. hot air oven 74. fully automatic autoclave 75. handy digital dissolved oxygen ( multi parameter ) 76. calcium rector with buffer effect 77. hot air circulating oven 78. x ray machine ( with cr system ) 79. hematology analyzer 80. fully auto biochemistry analyzer...

Indian Institute Of Technology - Gujarat

12060084 tender for supply of “refrigerated microcentrifuge along with various equipments” as per details and specifications shown in the annexure i at iit gandhinagar...

Central University Of Gujarat - Gujarat

7890541 rate contract for supply of laboratory chemicals, glass ware, plastic ware & miscellaneous items at cug plastic ware 1. 100 mm dish 2. 60 mm dish 3. 35 mm dish 4. t 75 cm2 flask 5. t 25 cm2 flask 6. 96 well plates 7. 96 well plates (non coated) 8. 48 well plates 9. 24 well plates 10. 12 well plates 11. 6 well plates 12. 50 ml tube 13. 15 ml tube 14. 2 ml micro centrifuge tube 15. 2 ml micro centrifuge tube (amber) 16. 1.5 ml eppendorf tube 17. pcr tube 18. 10 ml serological pipettes 19. serological pipettes 25 ml 20. cryo vials 21. 1 ml pipette tips 22. 20 200 μl pipette tips 23. 2 20 μl pipette tips 24. 5 ml pipette tips 25. autoclave bags 26. biohazard bags (big black bags) 27. confocal chamber slides 28. confocal cover slip 29. cryobox (25 well) 30. cryobox (96 well) 31. pcr tube box 32. cell lifter 33. cell scraper 34. fibronectin coated well plate 35. reservoirs 36. cryoboxes 5x5, 37. cryoboxes 12x8 38. conical tubes – 15 ml 39. conical tubes – 50 ml 40. serological pipettes – 10 ml 41. t75 flask 42. t25 flasks 43. tissue culture plates 100 mm 44. tissue culture plates 60 mm 45. tissue culture plates 35 mm 46. 6 well plate 47. 12 well plate 48. 24 well plate 49. 48 well plate 50. 96 well plate non treated 51. 96 well plate black 52. microcentrifuge tube (2 and 1.5 ml) 53. ultra centrifuge tube 54. centrifuge tube (2 and 1.5 ml) 55. cuvettes for electroporation 56. cuvettes for spectrophtometer 57. pcr tube 58. micropipettes tip (0.5, 200, 1000 and 59. cryobox 60. pcr tube box 61. culture glass flask 62. plant tissues culture tube 63. filter paper 64. bacterial culture tube, glass ware 1. pasteur pipettes 2. facs tube 3. borosil bottle 500 4. borosil bottle 1000 5. glass bottles 250 ml 6. facs tubes, cell culture media and other 1. fbs 2. syringe filter (0.2 u) 3. media filter (0.2 u) 4. rpmi (without hepes) 5. rpmi (without glucose) 6. dmem f12 7. dmem (low glucose) 8. dmem (without glucose) 9. dmem (high glucose) 10. hams f 12 (high glucose) 11. huvec media (part a+part b) 12. huvec media (part a) 13. reagent pack subculture reagent for saec cells 14. calcium free media 15. mem 16. hams f 12 17. mebm media 18. himesoxl mesenchymal stem cell expansion medium, reduced serum 19. cryo vials 20. autoclavable bags 21. rpmi (without hepes buffer) 22. mem 23. fetal bovine serum (fbs), antibiotics 1. penicillin+streptomycin pentrap antibiotic solution 2. antimycotic, 1. penicillin+streptomycin pentrap antibiotic solution 2. antimycotic 1. trypsin 2. rtase 3. taq polymerase 4. poly (a) polymerase 5. taq polymerase 6. rtaase 7. pngase 8. enzymes (re, ligase polymerase, etc), general chemicals and reagent 1. hepes 2. sodium pyruvate 3. chloroform (moleculannual/repair grade) 4. isopropyl alcohol (moleculannual/repair grade) 5. ethanol 6. ethyl alcohol (moleculannual/repair grade) 7. methanol 8. tris base 9. glycine 10. ecl solution 11. fixer 12. developer 13. dmso 14. mtt dye 15. bradford reagent 16. ammonium persulfate (moleculannual/repair biology grade) 17. acrylamide 18. bis acrylamide 19. sodium chloride 20. tween 20 21. etbr 22. agarose 23. hcl 24. naoh 25. trypan blue 26. dcfda 27. n acetyl cystine 28. h2o2 29. lipopolysaccharide from e.coli 30. dextran sulphate sodium salt (36500 50000 m wt) 31. acacetin 32. ponceau 33. annexin v 34. propodeum iodide 35. sterile glucose 36. 4perc. buffered paraformaldehyde, 37. glacial acetic acid 38. acetic acid 39. acetone 40. sds 41. sybr green rt pcr 42. evodiamine 43. rotenone 44. diphenyleneiodonium chloride (dpi) 45. lipofectamine 2000 transfection reagent 46. fibronectin lyophilized powder 47. s ampa 48. 3 methyladenine 49. trizol 50. h2so4 51. sodium chloride 52. tween 20 53. skim milk defatted milk powder 54. trypan blue dye 55. annexin v fitc 56. 57. sheath fluid 58. pha l (l phytohemagglutinin) 59. pha e (e phytohemagglutinin) 60. con a (concanavalin a) 61. swainsonine 62. cycloheximide 63. actinomycind 64. trypsin 65. penicillin+streptomycin pentrap antibiotic solution, 66. amphotericin antimycotic solution 67. cell scraper 68. sulpho nhs 69. mes monohydrate 70. dmso 71. edac 72. thionyl chloride 73. rink amide (aminomethyl)polystyrene 74. annexin v : pe apoptosis detection kit 75. egfr antibody (528) alexa fluor® 647 76. cdcl3 (chloroform d) nmr solvent 77. dextran from leuconostoc spp. mr ~70,000 78. gel filtration standard lyophilized 79. polycaprolactone, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 80. acetonitrile spectrophotometric grade 81. methanol 82. acetic acid 83. hcl 84. formic acid 85. acetone 86. sulfuric acid 87. sodium periodate 88. 1,1,1,3,3,3 hexafluoro 2 propanol 89. collagen from bovine achilles tendon 90. paraplast x tra® 91. live/dead® viability/cytotoxicity kit 92. ethanol annual/repair grade 93. separating funnel amber color 94. reagent bottle amber color 95. reagent bottle amber color 96. hellma® absorption cuvettes, micro 97. hellma® absorption cuvettes, ultra micro 98. thermo scientific nalgene filter holder with 114 mm diameter receiver, 500 ml upper chamber, 1000 ml receiver capacities 1 ea 99. aspirator flask axiva 100. norell® standard series™ 5 mm nmr tubes 101. limit 500 mhz frequency, l 8 in. 102. axiva ptfe syringe filters – sterile 103. axiva ptfe syringe filters – sterile 104. axiva chartered accountant syringe filters sterile 105. axiva chartered accountant syringe filters sterile 106. microscope cover slips, circulannual/repair 11 mm diameter 107. microscope cover slips, circulannual/repair 15 mm diameter 108. culture tubes: medium flat bottom with screw cap 109. culture tubes amber: medium flat bottom, with screw cap and liner 110. fisher scientific histoprep stainless steel base molds 111. 1.5 ml microcentrifuge tube 112. 2 ml microcentrifuge tubes 113. 2 ml microcentrifuge tubes (amber) 114. pcr tubes 115. 1 ml pipette tips 116. 20 200 pipette tips 117. 2 20 pipette tips 118. haemocytometer 119. cryo box plastic, 120. syringes 1 ml 121. syringes 2 ml 122. syringes 5 ml 123. syringes 50 ml 124. stainless steel forceps (blunt ) 125. stainless steel forceps (pointed) 126. cryogenic vial sterile 2.0 ml 127. ph paper 2 10.5) 128. parafilm m usa 129. glass slides standard grade 130. microscope cover glass standard grade 131. sterile scalpel blade no.11 132. stainless steel scalpel holder no.3 133. stainless steel forceps (blunt ) 134. stainless steel forceps (pointed) 135. standard mambrane filter (0.22um) 136. pipette fillers 137. sybr green 138. taqman probe 139. sequencing chemicals 140. primer synthesis 141. antibiotics 142. cloning vectors (plasmids) 143. bacterial cells 144. membranes for blotting 145. rt pcr and pcr chemicals 146. moleculannual/repair markers 147. bacterial culture media 148. plant tissue culture media 149. dyes 150. petri dish plates 151. trizmabase, tris 152. ethanol, methanol 153. edta 154. naoh 155. potassium acetate 156. sodium acetate 157. glacial acetic acid 158. propanol 2 159. chloroform 160. isoamyl alcohol 161. agarose 162. ethidium bromide, 163. bromophenol blue 164. sodium chloride 165. magnesium chloride 166. sodium doecyl sulfate 167. glycerol 168. iptg 169. x gal 170. solarite soils for tissue culture, antibody 1. gapdh abs 2. secondary antobody anti mice 3. secondary antobody anti rabbit 4. actin abs 5. lamin abs 6. alexa fluor 488 anti mouse 7. alexa fluor 568 anti rabbit 8. 9. anti egfr antibody 10. anti phospho egfr antibody (y1173) 11. vwf abs 12. brcc36 antibody 13. hmgcr antibody 14. cox 2 antibody 15. laminb1 antibody 16. p 21 antibody 17. cox 2 (complex ii) abs mitochondrial loading control 18. anti tubulin(tu 02) antibody 19. zeb 1 antibody 20. twist antibody 21. phospho chk1 (ser 345) (133d3) 22. total chk1 23. rad51 24. glutamate receptor 1 antibody 25. phospho p38 mapk (thr180/tyr182) 26. p38 mapk antibody, kit 1. human inflammation array q1 2. lipoxygenase inhibitor screening assay kit 3. hegf recombinant protein 4. insulin eliza kit 5. prostaglandin e2 (pge2) eia kit – monoclonal 6. dual luciferase® reporter assay system luciferase assay kit for nf κb 7. saec cells growth medium bullet kit 8. 8 ohdg elisa kit 9. griess reagent 10. prostaglandin e2 (pge2) eia kit monoclonal 11. kinase assay kit 12. glutamate release assay kit 13. growth factor kit 14. temphil rchartered accountant kit 15. ta cloning kit 16. gel extraction kit 17. miniprep kit 18. midiprep kit 19. rna and rnai isolation kit 20. dna isolation kit 21. protein isolation kit 22. pcr purification kit, inhibitor 1. phosphatase inhibitor 2. protease inhibitor 3. rnase inhibitor 4. actinomycin d 5. cyclohexamide (chx) 6. ns398 – cox 2 inhibitor 7. myxothiazol, primers/oligo dt 1. gapdh primer 2. primers: (1) human cysteinyl leukotrine receptor 1 (hcyslt1 receptor): n terminal / r1 forward, 5 atggatgaaacaggaaatctgacag 3; c terminal / r1 reverse, 5 cctcttctttatacatttcatatc 3 (2) human cysteinyl leukotrine receptor 2 (hcyslt2 receptor): n terminal / r2 forward, 5 accttcagcaataacaacagc 3; c terminal / r2 reverse, 5` cgtttctgtctgacgtatttc 3 3. rt primer (degenerate rt primer) for mirna, (hplc grade) sequence: 5’caggtccagtttttttttttttttvn3’ where (v=a, c and g), (n=a,c,g and t) 4. mir143 primer 5. u6 snrna primer 6. hmgcr primer 7. 8. primers for sirna p21 9. primers for sirna p27 10. primers for sirna control 11. cd1d primers 12. cd1d sequencing and analysis through maldi tof 13. cyclin e primer 14. cdk2 primer 15. si rna cyclin 16. si rna cdk2 life technologies (#1 ggagcuuaaccauccuaautt 3 ggaaguuucaguauuagautt 17. oligo dt 18. gnt iii primer and gnt v primer (for rt pcr and cloning) 19. integrin beta3 and beta6 primer (cloning) 20. sirna 21. e cadherin rt pcr primers 22. n cadherin rt pcr primers, 23. vimentin rt pcr primers 24. integrins rt pcr primers 25. laminin rt pcr primers 26. collagen rt pcr primers 27. fibronectin rt pcr primers 28. egfr rt pcr primers 29. pcna rt pcr primers 30. p53 rt pcr primers 31. hif1α rt pcr primers 32. vegf rt pcr primers, 23. vimentin rt pcr primers 24. integrins rt pcr primers 25. laminin rt pcr primers 26. collagen rt pcr primers 27. fibronectin rt pcr primers 28. egfr rt pcr primers 29. pcna rt pcr primers 30. p53 rt pcr primers 31. hif1α rt pcr primers 32. vegf rt pcr primers, proteins/ladder 1. precision marker western blotting 2. 100bp dna ladder 3. hegf recombinant protein 4. visfatin (mouse) protein 5. human ldl 6. il 1beta human recombinant protein 7. precision marker western blotting, cells 1. saec cells 2. human adipose derived mesenchymal stem cells, miscellaneous 1. gloves 2. blotting paper (western) 3. face mask 4. blotting paper 5. tissue rolls 6. x ray films, 7. skim milk defatted milk powder 8. parafilm 9. biohazard bags (big black bags) 10. pvdf membrane 11. co2 cylinder 12. liquid nitrogen 13. syringe filter 14. blotting paper 15. autoclave bags 16. mask 17. blotting paper 18. autoclavable bags 19. tissue rolls 20. phstrip 21. phstrip 22. phstrip 23. phstrip 24. freeze tag transparent 25. freeze tag 26. freeze tag, white lable 27. ph eletrode, 1. nitrogen gas 2. zero air gas 3. helium gas 4. argon gas 5. carbondioxide gas 6. acetylene gas 7. oxygen gas 8. nitrous oxide gas 9. hydrogen gas 10. liquid nitrogen gas 11. liquid helium gas, 1. beaker 5ml 2. beaker 10 ml 3. beaker 25ml 4. beaker 50ml 5. beaker 100ml 6. beaker 250ml 7. beaker 500ml 8. beaker 1000ml 9. round bottom flask 10ml 10. round bottom flask 25ml 11. round bottom flask 50ml 12. round bottom flask 100ml 13. round bottom flask 250ml 14. round bottom flask 500ml 15. round bottom flask 1000ml 16. volumetric flask 5ml 17. volumetric flask 10ml 18. volumetric flask 25ml 19. volumetric flask 50ml 20. volumetric flask 100ml 21. volumetric flask 250ml 22. volumetric flask 500ml 23. volumetric flask 1000ml 24. conical flask 50ml 25. conical flask 100ml 26. conical flask 250ml 27. conical flask 500ml 28. burette 25ml 29. burette 10ml 30. sample vial 5ml, 31. sample vial 15ml 32. sample vial 30ml 33. sample vial 10 ml 34. funnel different size 35. watch glass different size 36. petri dish different size 37. buckner funnel 38. filtration flask 60ml 39. filtration flask 125ml 40. filtration flask 250ml 41. glass road 42. dropping bottle with different size 43. measuring cylinder 5ml 44. measuring cylinder 10ml 45. measuring cylinder 25ml 46. measuring cylinder 50ml 47. measuring cylinder 100ml 48. pipette 1ml 49. pipette 2ml 50. pipette 5ml 51. pipette 10ml 52. pipette 25ml 53. wire gauge for lab 54. test tube rack with diff. shapes 55. test tube with different size 56. condenser with different size 57. column with different size 58. separating funnel 50ml 59. separating funnel 100ml 60. separating funnel 250ml 61. glass dropper 62. melting tube 63. capillary tube 64. cotton 65. characterization dishes (glass water bath) with different size 66. desiccator with different size 67. a 1, reduction adapters socket 14/23 cone 19/26 68. a 1, reduction adapters socket 14/23 cone 24/29 69. a 1, reduction adapters socket 14/23 cone 29/32 70. a 1, reduction adapters socket 19/26 cone 24/29 71. a 1, reduction adapters socket 19/26 cone 29/32 72. a 1, reduction adapters socket 24/29 cone 29/32 73. a 2, expansion adapters socket 19/26 cone 14/23 74. a 2, expansion adapters socket 24/29 cone 19/26 75. a 2, expansion adapters socket 24/32 cone 14/23 76. a 2, expansion adapters socket 29/32 cone 24/29 77. a 2, expansion adapters socket 29/32 cone 19/26 78. a 2, expansion adapters socket 29/32 cone 14/23 79. a 9, cone adapters, straight connection with stopcock, cone 14/23 80. a 9, cone adapters, straight connection with stopcock, cone 19/26 81. a 9, cone adapters, straight connection with, stopcock, cone 24/29 82. b 24, dropping bottles with pipette stopper, cap diff. sizes 83. silicon oil (for oil bath 250+0c) 84. round/octagon magnetic stirrer bannual/repair with pivot ring diff sizes 85. clamp diff size and shape 86. clamp stand 87. bosshead diff size and shape 88. magnetic retriever 89. tlc plates (merck) 90. distillation condenser with diff size 91. dishes crystallizing (oil bath) with diff size 92. glass stopper hexagonal/ round with diff neck size 93. syringe (0 50 μl) 94. tlc capillary 95. tlc chamber 96. bottles, dropping with pipette & rubber teat with diff sizes 97. vetro clean 98. flasks, filtering, bolt neck, with tubulation (250 ml) 99. dishes 100 x 50 100. dishes, culture, petri 50 x 17 101. micro centrifuge tubes (500015, 500017) 102. semi micro buchner funnel 103. magnetic bead 104. sample vial 10ml 105. centrifuge tubes: 500031 500041, etc....

Gujarat University - Gujarat

7461206 purchase of equipments/instruments for school of sciences 01 2 d gel analysis with software and western blot attachment: 2 d gel electrophoresis unit:03 freezing and cooling systems:04 visible spectrophotometer:05 refrigerated centrifuge:06 student binocular microscope:07 real time thermal cycler:08 general laboratory homogenizer:09 lyophilizer / freeze dryer:10 protein analysis system:11 phase contrast trinocular inverted microscope with imported camera attachment:12. semi automatic biochemistry analyzer:13. homogenizer:14. water purification system:15. co2incubator:16. portable chlorophyll meter:17. aabsorbance micro plate reader:18. gel documentation:19. uv transilluminator:20. atomic absorption spectrophotometer:21. laser tree hight measurement unit:22. preparative hplc:23. rotary evaporator:24. oil free ptfe diaphragm pump for rotary evaporator25. freezer:26. fume hood:27. spin coating machine:28. ultra sonic probe:29. uv chamber:30. hot plate with magnetic stirrer:31. digital melting point:32. research centrifuge:33. general purpose centrifuge:34. vortex mixer:35. uv visible spectrophotometer:36. micropipette:37. cuvette:38. ph meter:39. water purification system:40. density meter:41. ultrasonic interferometer:42. constant temperature water bath:43. hot air oven:44. digital precision balance:45. sonicator (bath):mathworks: 46.47. line printer:network storage array with 4 tb storage (lenovo emc px6 300d or higher: 48.high end desktop workstations: 49.51. ips led workstation monitorwireless bridge / access point 52.wireless lan (outside) access point / router 53.blade server 54.paper shredder: 55.56. oracle 12c:dgs 3100 24: 57.58. digital analytical balance:59. hot air oven:60. magnetic stirrer with hot plate:61. multi magnetic stirrer:62. quartz cuvettes:63. glass cuvettes:64. diaphragm vacuum pump:65. micro pipetts:66. vortex mixer:67. uv visible spectrophotometer:68. ph meter:69. water purification system:70. research centrifuge:71. ion analyze:72. b. o. d incubator:73. c. o. d. digestion apparatus:74. total dissolved solids meter:75. noise dosimeter / datalogger with pc interface:76. led modules for microscope zeiss axio lab.a1 with fl led:77. cell counter analyzer (cell count, viability, apoptosis, cell cycle and kinetics):78. co2 incubator:79. 2d gel analysis with software and western blot attachment:80. sds page electrophoresis unit:81. water purification system (a pre filtration kit (3 stage):82. freezing and cooling systems:83. research grade trino ocular microscope with phase contrast & digital camera:84. microplate spectrophotometer for nano drops:85. uv visible spectrophotometer*:86. visible spectrophotometer*:87. refrigerated centrifuge:88. student binocular microscope:89. general laboratory homogenizer:90. bio safety cabinet:91. specifications of 96 well uv vis absorbance microplate spectrophotometer:92. upgradation of existing shimadzu hplc system with refractive index detector and gel permeation chromatography software:93. trinocular phase contrast research high resolution microscope with photographic attachment, digital camera and software for image analysis:94. automated microbial identification and susceptibility testing system:95. water purification system (for 10 18 mhos conductivity water):96. weigh balance (0.1 mg to 120 g) :97. pre program uv vis spectrophotometer for water analyses:98. surface and interfacial tensiometer:99. ftir with atr facility:100. green house (gothic structure) ~288 sq. mt.:101. gel rocker:102. vortex mixture: 103. cooling incubator device: dimension about 300 350 l capacity 104. air conditioner for instrument labs (1.5 tons): with energy saving system and digital control 105. biomass grinder:106. biosafety cabinate / laminar air flow system class ii type a2: size: 4x2x2 107. binocular microscope: plan achromatic objectives , quadruple nosepiece, build in transmitted illumination system, universal infinity optical system 108. weighing machine (1 mg – 200 g): 109. microprocessor based flame photometer : with na, k, ca, li filters and compressor: having automatic ignition and auto gas shut off facility. with sodium (na) and potassium (k) filters, up to 5 points calibration, direct readout in pp, and meq/l, auto filter selection, auto ignition, 24 x 4 line lcd display, single aspiration, rs232 interface, printer attachments facility, with compressor and other accessories for lab and medical use; ca and li filers. 110. double distillation unit 5 7 l/h: quartz boiler, condenser, automatic cut off device, vertical model 111. lab fermenter 3 l: borosilicate jacketed glass vessel with air sparger , central shaft, acid alkali resistance , antifoam port, ph probe and temperature control , sampling port. 112. specifications for hammer mill: model: hammer mill make: stainless steel and carbon stainless steel it is available in multiple hammer styles the size of the instrument is varying. range: 6 60 inch. rotor diameter is 9 40 inch. grinder for cutting the material with varying particle sizes is available. replaceable plates are available with abrasion resistant steel. applied for the crushing of printed circuit boards, computer chips, floppy disks, cement, batteries, floppy disks and ceramics.113. biolog upgraded microstation system from ml2 to gen iii ml3115. micro station reader116. lattice dynamics kit:117. ultrasonic interferometer:118. klystron power supply119. digital readout 25 mhz 2 channel oscilloscope:120. 25 mhz 2 channel digital power scope:121. 50 mhz digital storage oscilloscope:122. gm counter:123. vacuum pump: 124. turbo molecular pump based vacuum system:125. rectangular electric muffle furnace:126. workstations127. software (academic license for multiusers):128. digital magnetic stirrer:129. digital hot plate:130. ultra sonic cleaner:131. quarts tube sealing system:132. temperature controller with sensors:133. cst software:134. spin coating unit:135. data logger:136. laboratory microscope:137. anti vibration table:138. kbr die punch:139. liquid nitrogen container: • 10 liter capacity 140. ferroelectric loop tracer:141. uv visible spectrophotometer:142. biosafety cabinet class ii b2:143. refrigerated centrifuge:144. incubator 37°c:145. two place automatic solvent extraction system:146. inverted research microscope:147. co2 incubator:148. multi port uv visible spectrophotometer system:149. ultra low temperature cabinet ( 20 degree deep freezer):150. cooling microcentrifuge:151. microcentrifuge:152. horizontal electrophoresis units:153. vertical electrophoresis units:154. micropipettes:155. chemiluminescence documentation system:156. high performance liquid chromatography (hplc):157. video camera panasonic model : ag ac 90 with camera bag with extra betary + tripode 158. polaroid polc3 cube hd digital video action camera camcorder (black) with accessories 159. sony handy came : model: pj380 with tripode + camera bag 160. canon dslr 70d with 18 135 lens with camera bag 161. sony alpha a58m 20.1mp digital slr camera (black) with slt a58y 18 55 and 55 200 mm lens, camera bag 162. mac system for sound recording & radio production for educational purpose processor 3.2 ghz 12 gb ram 2 tb hard drive updated processor 163. apogee duet for mac – usb (the first professional stereo audio interface for mac) accessories duet for mac breakout cable duet for mac breakout box additional lightning, 30 – pin, and usb cables (longer lengths available) 164. monitor speaker genelec 6010a or 6010b amplified monitor system (1 pair) with stand (1 pair) 165. studio microphone blue spark with accessories /sure wood box, custom, shock mount, custom pop filter166. rode nt1 a cardioid condenser microphone recording package with shure hd 202 ii closed back around the ear studio headphones and a tripod base microphone floor stand black 167. cable and connector kitt for audio video production 168. hdmi cable for video camera 169. mini displayport display port dp to vga adapter for new macbook pro air imac 170. video editing nle setup171. filter kit172. audio technica atr 6550 video camera condenser shotgun microphone 173. projector lw 330174. sony professional video camera model : pmw 200 with camera bag with extra battery + memory card + card readar + professionlnal tripode 175. go pro camera hero 4, water proof kit + lcd backpack + battery bacpack + b12scandick extreme 64 gb micro sd card with bag 176. 5d mark iii dslr camera with 24 105 mm lens (22.3 mp) with professional tripode and camera bag 177. canon eos 1200d 18mp digital slr camera (black) with 18 55mm and 55 250mm is ii lens, 8gb card and camera bag 178. nikon d3100 14.2mp digital slr camera (black) with af s 18 55mm nikkor vr kit lens, 8gb card and camera bag 179. 20 35 wide lens 20f2.8 for canon dslr 180. 50 block fix lense 1.4 for canon dslr 181. 70 300 tally lens for canon dslr 182. simpex 999 power zoom flash, synchro socket & cable, tripod mount, powe zoom 24mm 105mm 183. manfrotto 681b hd pro monopod 3 section (black) with head184. 47.3/120cm pro dslr dv camera tracking dolly slider video stabilizer system 185. dayled 800 bi color with digital display with stand 186. cool light with stand 187. led light (big size for camera) 188. reflectors standard size 189. reflectors disk reflector 5in 1 122 cm 190. croma curtain 20x20 (green) for video 191. croma curtain 20x20 (green) for video 192. white board size :6x4 193. soft board 6x3 194. video camera bag professional 195. extension board 5point 15mtr with 15 amp socket 196. extension board 5point 10mtr 197. transcend p8 15 in 1 usb 2.0 flash memory card reader (black) 198. sound recording software – daw – mac logic pro x 199. sony sound recorder pcm pro audio recorder 200. studio master cordless mic el series 201. jbl flip portable bluetooth stereo speaker (black) 202. portable ampli speaker (classroom talky) with recording , built in mp3 player, fm radio, max output power : 15w(uv polarizer fluorescent) + 2 graduated color filters (orange blue) + tulip flower lens hood + pop up flash diffuser (set of 3) cleaning pen + deluxe cleaning kit + center pinch lens cap w / cap keeper 172. audio technica atr 6550 video camera condenser shotgun microphone 173. projector lw 330174. sony professional video camera model : pmw 200 with camera bag with extra battery + memory card + card readar + professionlnal tripode 175. go pro camera hero 4, water proof kit + lcd backpack + battery bacpack + b12scandick extreme 64 gb micro sd card with bag 176. 5d mark iii dslr camera with 24 105 mm lens (22.3 mp) with professional tripode and camera bag 177. canon eos 1200d 18mp digital slr camera (black) with 18 55mm and 55 250mm is ii lens, 8gb card and camera bag 178. nikon d3100 14.2mp digital slr camera (black) with af s 18 55mm nikkor vr kit lens, 8gb card and camera bag 179. 20 35 wide lens 20f2.8 for canon dslr 180. 50 block fix lense 1.4 for canon dslr 181. 70 300 tally lens for canon dslr 182. simpex 999 power zoom flash, synchro socket & cable, tripod mount, powe zoom 24mm 105mm 183. manfrotto 681b hd pro monopod 3 section (black) with head184. 47.3/120cm pro dslr dv camera tracking dolly slider video stabilizer system 185. dayled 800 bi color with digital display with stand 186. cool light with stand 187. led light (big size for camera) 188. reflectors standard size 189. reflectors disk reflector 5in 1 122 cm 190. croma curtain 20x20 (green) for video 191. croma curtain 20x20 (green) for video 192. white board size :6x4 193. soft board 6x3 194. video camera bag professional 195. extension board 5point 15mtr with 15 amp socket 196. extension board 5point 10mtr 197. transcend p8 15 in 1 usb 2.0 flash memory card reader (black) 198. sound recording software – daw – mac logic pro x 199. sony sound recorder pcm pro audio recorder 200. studio master cordless mic el series 201. jbl flip portable bluetooth stereo speaker (black) 202. portable ampli speaker (classroom talky) with recording , built in mp3 player, fm radio, max output power : 15w203. ahuja 1000 microphone with stand 204. sony bdp s1100 blu ray disc player 205. lapel mic wireless 206. boom mic stand with fixed length boom w/ adjustable height of 16 to 23 207. amplifier ssb 80 208. power x 40 w rms speaker 209. memory card : sony sdhc uhs i 32gb memory card 94 mb/s 210. software adobe cc master collection for educational institute for nle video editing 211. software final cut pro for educational institute for video editing 212. wd my passport ultra 1 tb external hard disk for editing source 213. wd my book 3tb external hard drive storage usb 3.0 file backup and storage for editing data 214. sandisk ultra 32gb micro usb 2.0 otg pen drive 215. sandisk cruzer blade 32gb usb flash drive216. multimedia system for ppt without monitor217. video editing nle setup218. kaspersky security 3 year for editing setup...

Saurashtra University - Gujarat

5522631 supply of scientific equipments/ lab equipments, high speed homogenizer, stability chamber, inverted microscope (upgradable to fluorescence), refrigerated microcentrifuge, upright microscope (upgradable to fluorescence), rotary evaporation assembly with oil free vacuumpump, bio safety cabinet class ii,nitrogen evaporator (positive pressure), microtome, automated slide stainer,tensiometer, 40 °c deep freeze horizontal double door, refrigerated centrifuge high speed, autoclave automatic, balance....